Rw2G037550

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr2
Physical Location & Seq
Reverse (-)
61919994 .. 61921061
1068 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw2G037550.1

Sequence Viewer

Length: 423 bp
ATGGCTGTTACTTGTTCTCTGCCTCCTTGTTTCTCAATCCTAAAATCTGGTCCTGCTATAAAGCCTTTCAGCTCAGTTTTGAGGCTTAAACACACTTCTCAAGTCACAGTGCTCAAGAAAAGAACATCTGCAGTGCTCAAAATCAGATCTTGCTTCAGAGAAGAGGTTTTCGAGGATCGCTCCAACGGAATAATCTGCTACAAAGATGCCAGAGGGGAGATTATTTGCGAAGGATACGATGAAGGCCCTCGATATCACCACCAGAATCAAAGAATAGTTAATCAATCAAGAGATGCCGAGATCCTTGATCTTCTTCAACAGAGGTGGTTTAACTTCATGACAGACACAGAATTAGTCAAGGCTGAGAAAGGTGGTGTTCTGCAAGAGGGAATCAACTGCAATGGCTTCAACACTCTCCACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

140

Amino Acids

15.93

Weight (kDa)

8.56

Isoelectric Point (pI)

42.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012135)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 183, 295
AcuI CTGAAG 1 cut(s) 139
AgsI TTSAA 2 cut(s) 317, 409
AluBI AGCT 1 cut(s) 72
AluI AGCT 1 cut(s) 72
Alw21I GWGCWC 2 cut(s) 114, 138
AlwI GGATC 2 cut(s) 183, 295
AoxI GGCC 1 cut(s) 244
AspS9I GGNCC 2 cut(s) 50, 245
AsuHPI GGTGA 1 cut(s) 248
AvaII GGWCC 1 cut(s) 50
Bbv12I GWGCWC 2 cut(s) 114, 138
BciVI GTATCC 1 cut(s) 227
BfmI CTRYAG 1 cut(s) 129
BfuI GTATCC 1 cut(s) 227
BglII AGATCT 1 cut(s) 146
Bme18I GGWCC 1 cut(s) 50
BmgT120I GGNCC 2 cut(s) 50, 245
BmsI GCATC 2 cut(s) 196, 283
BplI GAGNNNNNCTC 2 cut(s) 164, 196
BpuEI CTTGAG 2 cut(s) 84, 98
Bse3DI GCAATG 1 cut(s) 406
BseMI GCAATG 1 cut(s) 406
BseMII CTCAG 2 cut(s) 87, 354
BshFI GGCC 1 cut(s) 246
BsiHKAI GWGCWC 2 cut(s) 114, 138
BsnI GGCC 1 cut(s) 246
Bsp1286I GDGCHC 2 cut(s) 114, 138
Bsp143I GATC 4 cut(s) 146, 175, 300, 307
BspANI GGCC 1 cut(s) 246
BspCNI CTCAG 2 cut(s) 86, 355
BspHI TCATGA 1 cut(s) 336
BspMAI CTGCAG 1 cut(s) 133
BspPI GGATC 2 cut(s) 183, 295
BsrDI GCAATG 1 cut(s) 406
BssMI GATC 4 cut(s) 146, 175, 300, 307
Bst4CI ACNGT 1 cut(s) 109
Bst6I CTCTTC 1 cut(s) 156
BstDEI CTNAG 2 cut(s) 73, 363
BstKTI GATC 4 cut(s) 149, 178, 303, 310
BstMBI GATC 4 cut(s) 146, 175, 300, 307
BstSFI CTRYAG 1 cut(s) 129
BstX2I RGATCY 2 cut(s) 146, 300
BstYI RGATCY 2 cut(s) 146, 300
BsuI GTATCC 1 cut(s) 227
BsuRI GGCC 1 cut(s) 246
BtsI GCAGTG 1 cut(s) 138
BtsIMutI CAGTG 2 cut(s) 114, 138
CciI TCATGA 1 cut(s) 336
Cfr13I GGNCC 2 cut(s) 50, 245
CspCI CAANNNNNGTGG 2 cut(s) 305, 340
CviAII CATG 1 cut(s) 337
CviJI RGCY 7 cut(s) 5, 64, 72, 85, 246, 362, 405
CviKI_1 RGCY 7 cut(s) 5, 64, 72, 85, 246, 362, 405
DdeI CTNAG 2 cut(s) 73, 363
DpnI GATC 4 cut(s) 148, 177, 302, 309
DpnII GATC 4 cut(s) 146, 175, 300, 307
Eam1104I CTCTTC 1 cut(s) 156
EarI CTCTTC 1 cut(s) 156
Eco32I GATATC 1 cut(s) 254
Eco47I GGWCC 1 cut(s) 50
Eco57I CTGAAG 1 cut(s) 139
EcoO109I RGGNCCY 1 cut(s) 245
EcoRV GATATC 1 cut(s) 254
FaeI CATG 1 cut(s) 340
FaiI YATR 2 cut(s) 59, 338
FatI CATG 1 cut(s) 336
HaeIII GGCC 1 cut(s) 246
Hin1II CATG 1 cut(s) 340
HinfI GANTC 2 cut(s) 265, 390
HphI GGTGA 1 cut(s) 248
Hpy188I TCNGA 2 cut(s) 146, 158
Hpy188III TCNNGA 3 cut(s) 115, 288, 337
HpyAV CCTTC 2 cut(s) 224, 236
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4V TGCA 3 cut(s) 131, 382, 399
HpyF3I CTNAG 2 cut(s) 73, 363
Hsp92II CATG 1 cut(s) 340
Kzo9I GATC 4 cut(s) 146, 175, 300, 307
LmnI GCTCC 1 cut(s) 185
LpnPI CCDG 4 cut(s) 33, 66, 223, 275
LweI GCATC 2 cut(s) 196, 283
MaeIII GTNAC 2 cut(s) 7, 103
MalI GATC 4 cut(s) 148, 177, 302, 309
MboI GATC 4 cut(s) 146, 175, 300, 307
MboII GAAGA 3 cut(s) 173, 302, 305
MflI RGATCY 2 cut(s) 146, 300
MhlI GDGCHC 2 cut(s) 114, 138
MluCI AATT 1 cut(s) 350
MmeI TCCRAC 1 cut(s) 207
MnlI CCTC 8 cut(s) 33, 75, 157, 166, 206, 258, 315, 379
MseI TTAA 3 cut(s) 87, 279, 330
NdeII GATC 4 cut(s) 146, 175, 300, 307
NlaIII CATG 1 cut(s) 340
NmeAIII GCCGAG 1 cut(s) 322
NmuCI GTSAC 1 cut(s) 103
PagI TCATGA 1 cut(s) 336
PfeI GAWTC 2 cut(s) 265, 390
PspPI GGNCC 2 cut(s) 50, 245
PstI CTGCAG 1 cut(s) 133
PsuI RGATCY 2 cut(s) 146, 300
SaqAI TTAA 3 cut(s) 87, 279, 330
Sau3AI GATC 4 cut(s) 146, 175, 300, 307
Sau96I GGNCC 2 cut(s) 50, 245
SduI GDGCHC 2 cut(s) 114, 138
SetI ASST 4 cut(s) 74, 168, 326, 373
SfaNI GCATC 2 cut(s) 196, 283
SfcI CTRYAG 1 cut(s) 129
SinI GGWCC 1 cut(s) 50
SmlI CTYRAG 2 cut(s) 99, 113
SmoI CTYRAG 2 cut(s) 99, 113
Sse9I AATT 1 cut(s) 350
TaaI ACNGT 1 cut(s) 109
TaqI TCGA 2 cut(s) 171, 250
TasI AATT 1 cut(s) 350
TfiI GAWTC 2 cut(s) 265, 390
Tru1I TTAA 3 cut(s) 87, 279, 330
Tru9I TTAA 3 cut(s) 87, 279, 330
TscAI CASTG 2 cut(s) 114, 138
TseFI GTSAC 1 cut(s) 103
Tsp45I GTSAC 1 cut(s) 103
TspDTI ATGAA 2 cut(s) 255, 325
TspGWI ACGGA 1 cut(s) 201
TspRI CASTG 2 cut(s) 114, 138
VpaK11BI GGWCC 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.