Prupe.1G144000_v2.0.a1

Heavy metal-associated isoprenylated plant protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
11327351 .. 11327913
563 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G144000.1

Sequence Viewer

Length: 390 bp
ATGGGAAAGAAGAAGAATAAAAATGATCAAGAAGCCAAAGTAATTGTGGCAGAATTCAGCGTCTCAATGCACTGTAATGCATGTGAAAGAACCGTTGCTAAAACTCTTTCCAAACTCAAAGGGGTGGAGAAGTTTACGACAGACATGAACAAGCACAAGGTTGTTGTGACAGGGAAGATGGACCCACAAAAGGTTTTGAAGAAACTGAGGAAGAAGACGGGCAAGAAAGTAGAGATTGTGGTTGACAAGGAAGAAAAACCAAACGATGCTTCTGATGACGGCAATTTGGCAAAACCAAATGTTTATCCAAACTTTTTTGACTGTTGCAAAGAGACTGATATTCTAATGATGTTTAGTGATGAGAACCCTAATGCTTGTTGCATAATGTAA

Protein Analysis

130

Amino Acids

14.53

Weight (kDa)

8.98

Isoelectric Point (pI)

24.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011957)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 53
AfiI CCNNNNNNNGG 1 cut(s) 190
AgsI TTSAA 1 cut(s) 199
AjuI GAANNNNNNNTTGG 2 cut(s) 253, 285
Alw26I GTCTC 2 cut(s) 67, 326
ApoI RAATTY 1 cut(s) 53
AspS9I GGNCC 1 cut(s) 181
AvaII GGWCC 1 cut(s) 181
BbsI GAAGAC 1 cut(s) 221
BccI CCATC 1 cut(s) 172
BceAI ACGGC 1 cut(s) 295
BclI TGATCA 1 cut(s) 25
BcoDI GTCTC 2 cut(s) 67, 326
Bme18I GGWCC 1 cut(s) 181
BmgT120I GGNCC 1 cut(s) 181
BmiI GGNNCC 1 cut(s) 183
BmsI GCATC 1 cut(s) 256
BpiI GAAGAC 1 cut(s) 221
Bsc4I CCNNNNNNNGG 1 cut(s) 190
BseLI CCNNNNNNNGG 1 cut(s) 190
BseMII CTCAG 1 cut(s) 197
BslI CCNNNNNNNGG 1 cut(s) 190
BsmAI GTCTC 2 cut(s) 67, 326
BsmBI CGTCTC 1 cut(s) 67
Bsp143I GATC 1 cut(s) 25
BspCNI CTCAG 1 cut(s) 198
BspLI GGNNCC 1 cut(s) 183
BssMI GATC 1 cut(s) 25
Bst4CI ACNGT 3 cut(s) 74, 94, 323
BstDEI CTNAG 1 cut(s) 206
BstKTI GATC 1 cut(s) 28
BstMAI GTCTC 2 cut(s) 67, 326
BstMBI GATC 1 cut(s) 25
BstNSI RCATGY 1 cut(s) 84
BstV2I GAAGAC 1 cut(s) 221
BtsIMutI CAGTG 1 cut(s) 70
Cfr13I GGNCC 1 cut(s) 181
CseI GACGC 1 cut(s) 49
CviAII CATG 2 cut(s) 81, 145
CviJI RGCY 1 cut(s) 35
CviKI_1 RGCY 1 cut(s) 35
DdeI CTNAG 1 cut(s) 206
DpnI GATC 1 cut(s) 27
DpnII GATC 1 cut(s) 25
Eco47I GGWCC 1 cut(s) 181
EcoRI GAATTC 1 cut(s) 53
EcoT22I ATGCAT 1 cut(s) 82
Esp3I CGTCTC 1 cut(s) 67
FaeI CATG 2 cut(s) 84, 148
FaiI YATR 3 cut(s) 82, 146, 383
FatI CATG 2 cut(s) 80, 144
FbaI TGATCA 1 cut(s) 25
HgaI GACGC 1 cut(s) 49
Hin1II CATG 2 cut(s) 84, 148
HincII GTYRAC 1 cut(s) 244
HindII GTYRAC 1 cut(s) 244
Hpy166II GTNNAC 2 cut(s) 135, 244
Hpy188I TCNGA 1 cut(s) 274
Hpy188III TCNNGA 1 cut(s) 29
Hpy8I GTNNAC 2 cut(s) 135, 244
HpyCH4III ACNGT 3 cut(s) 74, 94, 323
HpyCH4V TGCA 4 cut(s) 70, 80, 327, 381
HpyF3I CTNAG 1 cut(s) 206
Hsp92II CATG 2 cut(s) 84, 148
Ksp22I TGATCA 1 cut(s) 25
Kzo9I GATC 1 cut(s) 25
LpnPI CCDG 1 cut(s) 156
LweI GCATC 1 cut(s) 256
MaeIII GTNAC 1 cut(s) 166
MalI GATC 1 cut(s) 27
MboI GATC 1 cut(s) 25
MboII GAAGA 7 cut(s) 22, 25, 187, 211, 223, 226, 263
MluCI AATT 3 cut(s) 42, 53, 283
MnlI CCTC 1 cut(s) 201
Mph1103I ATGCAT 1 cut(s) 82
MslI CAYNNNNRTG 1 cut(s) 75
NdeII GATC 1 cut(s) 25
NlaIII CATG 2 cut(s) 84, 148
NlaIV GGNNCC 1 cut(s) 183
NmuCI GTSAC 1 cut(s) 166
NsiI ATGCAT 1 cut(s) 82
NspI RCATGY 1 cut(s) 84
PspN4I GGNNCC 1 cut(s) 183
PspPI GGNCC 1 cut(s) 181
RseI CAYNNNNRTG 1 cut(s) 75
Sau3AI GATC 1 cut(s) 25
Sau96I GGNCC 1 cut(s) 181
SetI ASST 2 cut(s) 162, 195
SfaNI GCATC 1 cut(s) 256
SgeI CNNG 9 cut(s) 41, 93, 157, 163, 169, 183, 231, 235, 259
SinI GGWCC 1 cut(s) 181
SmiMI CAYNNNNRTG 1 cut(s) 75
Sse9I AATT 3 cut(s) 42, 53, 283
TaaI ACNGT 3 cut(s) 74, 94, 323
TasI AATT 3 cut(s) 42, 53, 283
TscAI CASTG 1 cut(s) 77
TseFI GTSAC 1 cut(s) 166
Tsp45I GTSAC 1 cut(s) 166
TspDTI ATGAA 1 cut(s) 161
TspRI CASTG 1 cut(s) 77
VpaK11BI GGWCC 1 cut(s) 181
XapI RAATTY 1 cut(s) 53
XceI RCATGY 1 cut(s) 84
XcmI CCANNNNNNNNNTGG 1 cut(s) 43
Zsp2I ATGCAT 1 cut(s) 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.