Prupe.1G363800_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0011876
Physical Location & Seq
Reverse (-)
33447472 .. 33448917
1446 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G363800.2

Sequence Viewer

Length: 336 bp
ATGGCGGTTTCTGATGCAGTGGCTGGGAACTTGACGACGATCTACGTGGCAGTGATCACAGGGATCAAGGCGTATGCGGTGGTGTTTGGTCAGAGCTTCAGTGGTGGCTTTGTGTTAATCGTGTCCACCATCGTGGTGTGCCTTATCCTGATTGCGACTCTGACGTGGGACGTGTCCCGTAAAGCCACGTATGCAATCCGGCGCGACCATTCTGTTCATGTCCACGACATGTGCAAGGGTGGTATTTGCTGGCATGGTGTCGCTGTCCAGTCGTCGGCTTCTGAGGTCCGGCTTAGGCTCCCGCACCAACTCAGCTACGGCTCGTCGTTAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

11.88

Weight (kDa)

8.96

Isoelectric Point (pI)

39.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011876)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G75810
fragaria_vesca FvH4_2g38290
malus_domestica MD08G1011100.v1.1 MD15G1011100.v1.1
prunus_persica Prupe.1G363800_v2.0.a1 Prupe.1G363800_v2.0.a1
pyrus_communis pycom08g00980 pycom15g00950
rosa_chinensis RchiOBHm_Chr6g0303091
rosa_laevigata RLG00000011109
rosa_multiflora Rmu_sc0008911.1_g000002 Rmu_sc0009943.1_g000001
rosa_roxburghii Rroxscaffold_7G00165030
rosa_rugosa Rorug06G0319200
rosa_samantha Rh6AG432900 Rh6BG469800 Rh6DG432000
rosa_wichuraiana Rw1G004450 Rw6G037520

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 204
AciI CCGC 3 cut(s) 5, 77, 302
AclWI GGATC 1 cut(s) 71
AcuI CTGAAG 1 cut(s) 82
AfiI CCNNNNNNNGG 1 cut(s) 274
AflIII ACRYGT 2 cut(s) 171, 228
AjiI CACGTC 2 cut(s) 165, 172
AleI CACNNNNGTG 1 cut(s) 131
AluBI AGCT 2 cut(s) 96, 315
AluI AGCT 2 cut(s) 96, 315
AlwI GGATC 1 cut(s) 71
AlwNI CAGNNNCTG 1 cut(s) 23
AspLEI GCGC 1 cut(s) 204
AspS9I GGNCC 1 cut(s) 286
AvaII GGWCC 1 cut(s) 286
BccI CCATC 1 cut(s) 137
BceAI ACGGC 1 cut(s) 334
BclI TGATCA 1 cut(s) 54
Bme18I GGWCC 1 cut(s) 286
BmgBI CACGTC 2 cut(s) 165, 172
BmgT120I GGNCC 1 cut(s) 286
BmiI GGNNCC 1 cut(s) 299
BmsI GCATC 1 cut(s) 4
Bpu10I CCTNAGC 1 cut(s) 293
BsaAI YACGTR 2 cut(s) 46, 189
Bsc4I CCNNNNNNNGG 1 cut(s) 274
Bse1I ACTGG 1 cut(s) 268
BseLI CCNNNNNNNGG 1 cut(s) 274
BseMII CTCAG 2 cut(s) 273, 325
BseNI ACTGG 1 cut(s) 268
BseYI CCCAGC 1 cut(s) 23
Bsh1236I CGCG 1 cut(s) 204
BsiSI CCGG 2 cut(s) 199, 289
BslFI GGGAC 2 cut(s) 160, 182
BslI CCNNNNNNNGG 1 cut(s) 274
BsmFI GGGAC 2 cut(s) 160, 182
Bsp143I GATC 3 cut(s) 39, 54, 63
BspACI CCGC 3 cut(s) 5, 77, 302
BspCNI CTCAG 2 cut(s) 274, 324
BspFNI CGCG 1 cut(s) 204
BspLI GGNNCC 1 cut(s) 299
BspPI GGATC 1 cut(s) 71
BsrI ACTGG 1 cut(s) 268
BssMI GATC 3 cut(s) 39, 54, 63
BstBAI YACGTR 2 cut(s) 46, 189
BstC8I GCNNGC 1 cut(s) 251
BstDEI CTNAG 3 cut(s) 282, 293, 311
BstFNI CGCG 1 cut(s) 204
BstHHI GCGC 1 cut(s) 204
BstKTI GATC 3 cut(s) 42, 57, 66
BstMBI GATC 3 cut(s) 39, 54, 63
BstMWI GCNNNNNNNGC 1 cut(s) 191
BstNSI RCATGY 1 cut(s) 232
BstUI CGCG 1 cut(s) 204
BstXI CCANNNNNNTGG 1 cut(s) 133
BtrI CACGTC 2 cut(s) 165, 172
BtsI GCAGTG 2 cut(s) 24, 57
BtsIMutI CAGTG 3 cut(s) 24, 57, 106
Cac8I GCNNGC 1 cut(s) 251
CaiI CAGNNNCTG 1 cut(s) 23
CfoI GCGC 1 cut(s) 204
Cfr13I GGNCC 1 cut(s) 286
CviAII CATG 3 cut(s) 218, 229, 254
CviJI RGCY 9 cut(s) 23, 96, 108, 185, 278, 292, 298, 315, 321
CviKI_1 RGCY 9 cut(s) 23, 96, 108, 185, 278, 292, 298, 315, 321
DdeI CTNAG 3 cut(s) 282, 293, 311
DpnI GATC 3 cut(s) 41, 56, 65
DpnII GATC 3 cut(s) 39, 54, 63
Eco47I GGWCC 1 cut(s) 286
Eco57I CTGAAG 1 cut(s) 82
FaeI CATG 3 cut(s) 221, 232, 257
FaiI YATR 5 cut(s) 75, 192, 219, 230, 255
FaqI GGGAC 2 cut(s) 160, 182
FatI CATG 3 cut(s) 217, 228, 253
FauI CCCGC 1 cut(s) 309
FbaI TGATCA 1 cut(s) 54
GlaI GCGC 1 cut(s) 203
GsaI CCCAGC 1 cut(s) 27
HapII CCGG 2 cut(s) 199, 289
HhaI GCGC 1 cut(s) 204
Hin1II CATG 3 cut(s) 221, 232, 257
Hin6I GCGC 1 cut(s) 202
HinP1I GCGC 1 cut(s) 202
HinfI GANTC 1 cut(s) 157
HpaII CCGG 2 cut(s) 199, 289
Hpy166II GTNNAC 2 cut(s) 126, 223
Hpy188I TCNGA 4 cut(s) 13, 93, 162, 283
Hpy188III TCNNGA 1 cut(s) 148
Hpy8I GTNNAC 2 cut(s) 126, 223
Hpy99I CGWCG 3 cut(s) 40, 277, 328
HpyCH4IV ACGT 4 cut(s) 45, 164, 171, 188
HpyCH4V TGCA 3 cut(s) 17, 194, 234
HpyF10VI GCNNNNNNNGC 1 cut(s) 191
HpyF3I CTNAG 3 cut(s) 282, 293, 311
HpySE526I ACGT 4 cut(s) 45, 164, 171, 188
Hsp92II CATG 3 cut(s) 221, 232, 257
HspAI GCGC 1 cut(s) 202
Ksp22I TGATCA 1 cut(s) 54
Kzo9I GATC 3 cut(s) 39, 54, 63
LmnI GCTCC 1 cut(s) 303
LpnPI CCDG 7 cut(s) 9, 45, 161, 212, 235, 281, 302
LweI GCATC 1 cut(s) 4
MaeII ACGT 4 cut(s) 45, 164, 171, 188
MalI GATC 3 cut(s) 41, 56, 65
MboI GATC 3 cut(s) 39, 54, 63
MluCI AATT 1 cut(s) 331
MlyI GAGTC 1 cut(s) 151
MnlI CCTC 1 cut(s) 277
MseI TTAA 2 cut(s) 116, 329
MslI CAYNNNNRTG 2 cut(s) 131, 134
MspI CCGG 2 cut(s) 199, 289
MvnI CGCG 1 cut(s) 204
MwoI GCNNNNNNNGC 1 cut(s) 191
NdeII GATC 3 cut(s) 39, 54, 63
NlaIII CATG 3 cut(s) 221, 232, 257
NlaIV GGNNCC 1 cut(s) 299
NspI RCATGY 1 cut(s) 232
OliI CACNNNNGTG 1 cut(s) 131
PciI ACATGT 1 cut(s) 228
PleI GAGTC 1 cut(s) 151
PpsI GAGTC 1 cut(s) 151
Ppu21I YACGTR 2 cut(s) 46, 189
PscI ACATGT 1 cut(s) 228
PspFI CCCAGC 1 cut(s) 23
PspN4I GGNNCC 1 cut(s) 299
PspPI GGNCC 1 cut(s) 286
PstNI CAGNNNCTG 1 cut(s) 23
RseI CAYNNNNRTG 2 cut(s) 131, 134
SaqAI TTAA 2 cut(s) 116, 329
Sau3AI GATC 3 cut(s) 39, 54, 63
Sau96I GGNCC 1 cut(s) 286
SchI GAGTC 1 cut(s) 151
SetI ASST 7 cut(s) 48, 98, 167, 174, 191, 288, 317
SfaNI GCATC 1 cut(s) 4
SinI GGWCC 1 cut(s) 286
SmiMI CAYNNNNRTG 2 cut(s) 131, 134
Sse9I AATT 1 cut(s) 331
SsiI CCGC 3 cut(s) 5, 77, 302
TaiI ACGT 4 cut(s) 48, 167, 174, 191
TasI AATT 1 cut(s) 331
Tru1I TTAA 2 cut(s) 116, 329
Tru9I TTAA 2 cut(s) 116, 329
TscAI CASTG 3 cut(s) 24, 57, 106
TspDTI ATGAA 1 cut(s) 206
TspRI CASTG 3 cut(s) 24, 57, 106
VpaK11BI GGWCC 1 cut(s) 286
XceI RCATGY 1 cut(s) 232
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.