Prupe.1G498900_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0018526
Physical Location & Seq
Forward (+)
41314689 .. 41315215
527 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G498900.1

Sequence Viewer

Length: 288 bp
ATGGGTCAAGATCAAACCAAGCCAGCAAATGCTGGAAGCAATGATATTAAATTTAAAGGGGTGGATGTGACCGACAACACCGGCGACGTGACGGGATTTACCCACTTCGCCAACAGAACTGACGGGGCCGACAAGGGCAACAATAAAATCGAAGTTGATGATTTTAAAGCGAAGGGGAACAAGTCACACTTGAACGTACTTACTGACTTCGGCCATCGCGGTCAGGCGGGCGAGTCAGGCAAACAAGAAAACAAAGAGAACAAGCAACTTCAGCAGGCAAGCAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

10.23

Weight (kDa)

6.26

Isoelectric Point (pI)

17.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 219
AciI CCGC 2 cut(s) 219, 227
AcoI YGGCCR 1 cut(s) 211
AcsI RAATTY 1 cut(s) 50
AcuI CTGAAG 1 cut(s) 254
AfaI GTAC 1 cut(s) 198
AgsI TTSAA 1 cut(s) 193
AjiI CACGTC 1 cut(s) 88
AoxI GGCC 2 cut(s) 126, 211
ApoI RAATTY 1 cut(s) 50
AspS9I GGNCC 1 cut(s) 126
BccI CCATC 1 cut(s) 222
BmgBI CACGTC 1 cut(s) 88
BmgT120I GGNCC 1 cut(s) 126
BmiI GGNNCC 1 cut(s) 127
Bse118I RCCGGY 1 cut(s) 80
Bse3DI GCAATG 1 cut(s) 46
BseGI GGATG 1 cut(s) 70
BseMI GCAATG 1 cut(s) 46
Bsh1236I CGCG 1 cut(s) 219
BshFI GGCC 2 cut(s) 128, 213
BsiSI CCGG 1 cut(s) 81
BsnI GGCC 2 cut(s) 128, 213
Bsp143I GATC 1 cut(s) 10
BspACI CCGC 2 cut(s) 219, 227
BspANI GGCC 2 cut(s) 128, 213
BspFNI CGCG 1 cut(s) 219
BspLI GGNNCC 1 cut(s) 127
BsrDI GCAATG 1 cut(s) 46
BsrFI RCCGGY 1 cut(s) 80
BssAI RCCGGY 1 cut(s) 80
BssMI GATC 1 cut(s) 10
BstC8I GCNNGC 4 cut(s) 24, 229, 276, 280
BstF5I GGATG 1 cut(s) 70
BstFNI CGCG 1 cut(s) 219
BstKTI GATC 1 cut(s) 13
BstMBI GATC 1 cut(s) 10
BstMWI GCNNNNNNNGC 2 cut(s) 237, 271
BstUI CGCG 1 cut(s) 219
BsuRI GGCC 2 cut(s) 128, 213
BtgZI GCGATG 1 cut(s) 200
BtrI CACGTC 1 cut(s) 88
BtsCI GGATG 1 cut(s) 70
Cac8I GCNNGC 4 cut(s) 24, 229, 276, 280
Cfr10I RCCGGY 1 cut(s) 80
Cfr13I GGNCC 1 cut(s) 126
Csp6I GTAC 1 cut(s) 197
CviJI RGCY 3 cut(s) 22, 128, 213
CviKI_1 RGCY 3 cut(s) 22, 128, 213
CviQI GTAC 1 cut(s) 197
DpnI GATC 1 cut(s) 12
DpnII GATC 1 cut(s) 10
DraI TTTAAA 2 cut(s) 55, 166
EaeI YGGCCR 1 cut(s) 211
Eco57I CTGAAG 1 cut(s) 254
FalI AAGNNNNNCTT 2 cut(s) 173, 205
FauI CCCGC 1 cut(s) 220
FokI GGATG 1 cut(s) 77
HaeIII GGCC 2 cut(s) 128, 213
HapII CCGG 1 cut(s) 81
HinfI GANTC 1 cut(s) 233
HpaII CCGG 1 cut(s) 81
Hpy188III TCNNGA 1 cut(s) 8
Hpy99I CGWCG 1 cut(s) 89
HpyAV CCTTC 1 cut(s) 166
HpyCH4IV ACGT 2 cut(s) 87, 195
HpyF10VI GCNNNNNNNGC 2 cut(s) 237, 271
HpySE526I ACGT 2 cut(s) 87, 195
Kzo9I GATC 1 cut(s) 10
LpnPI CCDG 6 cut(s) 18, 36, 94, 209, 222, 260
MaeII ACGT 2 cut(s) 87, 195
MaeIII GTNAC 3 cut(s) 67, 88, 183
MalI GATC 1 cut(s) 12
MboI GATC 1 cut(s) 10
MfeI CAATTG 1 cut(s) 283
MluCI AATT 2 cut(s) 50, 283
MlyI GAGTC 1 cut(s) 242
MseI TTAA 3 cut(s) 48, 54, 165
MspI CCGG 1 cut(s) 81
MunI CAATTG 1 cut(s) 283
MvnI CGCG 1 cut(s) 219
MwoI GCNNNNNNNGC 2 cut(s) 237, 271
NdeII GATC 1 cut(s) 10
NlaIV GGNNCC 1 cut(s) 127
NmuCI GTSAC 3 cut(s) 67, 88, 183
PleI GAGTC 1 cut(s) 241
PpsI GAGTC 1 cut(s) 241
PspN4I GGNNCC 1 cut(s) 127
PspPI GGNCC 1 cut(s) 126
RsaI GTAC 1 cut(s) 198
RsaNI GTAC 1 cut(s) 197
SaqAI TTAA 3 cut(s) 48, 54, 165
Sau3AI GATC 1 cut(s) 10
Sau96I GGNCC 1 cut(s) 126
SchI GAGTC 1 cut(s) 242
SetI ASST 2 cut(s) 90, 198
SgrAI CRCCGGYG 1 cut(s) 80
Sse9I AATT 2 cut(s) 50, 283
SsiI CCGC 2 cut(s) 219, 227
TaiI ACGT 2 cut(s) 90, 198
TaqI TCGA 1 cut(s) 150
TaqII GACCGA 1 cut(s) 86
TasI AATT 2 cut(s) 50, 283
Tru1I TTAA 3 cut(s) 48, 54, 165
Tru9I TTAA 3 cut(s) 48, 54, 165
TseFI GTSAC 3 cut(s) 67, 88, 183
Tsp45I GTSAC 3 cut(s) 67, 88, 183
XapI RAATTY 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.