Prupe.2G194100_v2.0.a1

cytochrome

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
OG0011592
Physical Location & Seq
Forward (+)
23237839 .. 23240525
2687 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G194100.1

Sequence Viewer

Length: 405 bp
ATGGCTTCAGATTCTCAAGTTTATCATTTCGATGAGGTGGCCAAGCACAACCACAAGAAAGATTGCTGGATCATAATCTCTGGAAAGGTTTATGATGTCACCCCTTTTTTGGAGGATCACCCTGGGGGCGATGAAGTGTTGCTATTAGCAGTCGAGAAAGATGCAACAGATGATTTTAATGATGTGGGCCACAGTGATTCTGCGAAGGAGCAGATGGAAAAATTTTATGTAGGCAAGGTTGACACATCCACCATACCAGAACAGCCAAGTTACAAGCTTCCTGCTCAAACAACTCCTCCATCCGGGCAATCTTCTGGATTTGTGGTAAAGCTGTTACAGTTTCTGCTGCCCTTGTTGATCTTGGGGGCTGCATTTGCTCTGCAATACTACGGGAAGAAGAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cyt-b5

Protein Analysis

135

Amino Acids

14.88

Weight (kDa)

5.23

Isoelectric Point (pI)

41.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 77, 123
AcoI YGGCCR 1 cut(s) 39
AcsI RAATTY 1 cut(s) 221
AfiI CCNNNNNNNGG 2 cut(s) 109, 302
AjnI CCWGG 1 cut(s) 121
AluBI AGCT 2 cut(s) 277, 331
AluI AGCT 2 cut(s) 277, 331
AlwI GGATC 2 cut(s) 77, 123
AlwNI CAGNNNCTG 1 cut(s) 343
AoxI GGCC 2 cut(s) 39, 187
ApeKI GCWGC 2 cut(s) 346, 368
ApoI RAATTY 1 cut(s) 221
AspS9I GGNCC 1 cut(s) 187
AsuC2I CCSGG 1 cut(s) 304
AsuHPI GGTGA 2 cut(s) 91, 110
BalI TGGCCA 1 cut(s) 41
BbvI GCAGC 2 cut(s) 333, 355
BccI CCATC 2 cut(s) 208, 307
BcgI CGANNNNNNTGC 2 cut(s) 143, 177
BciT130I CCWGG 1 cut(s) 123
BcnI CCSGG 1 cut(s) 304
BisI GCNGC 2 cut(s) 347, 369
BlsI GCNGC 2 cut(s) 348, 370
Bme1390I CCNGG 2 cut(s) 123, 304
BmgT120I GGNCC 1 cut(s) 187
BmrFI CCNGG 2 cut(s) 123, 304
BmsI GCATC 1 cut(s) 151
BpuMI CCSGG 1 cut(s) 304
BsaBI GATNNNNATC 1 cut(s) 74
BsaJI CCNNGG 2 cut(s) 121, 122
BsaXI ACNNNNNCTCC 2 cut(s) 280, 310
Bsc4I CCNNNNNNNGG 2 cut(s) 109, 302
Bse8I GATNNNNATC 1 cut(s) 74
BseBI CCWGG 1 cut(s) 123
BseDI CCNNGG 2 cut(s) 121, 122
BseGI GGATG 2 cut(s) 245, 299
BseJI GATNNNNATC 1 cut(s) 74
BseLI CCNNNNNNNGG 2 cut(s) 109, 302
BseRI GAGGAG 1 cut(s) 285
BseXI GCAGC 2 cut(s) 333, 355
BshFI GGCC 2 cut(s) 41, 189
BsiSI CCGG 1 cut(s) 303
BslI CCNNNNNNNGG 2 cut(s) 109, 302
BsnI GGCC 2 cut(s) 41, 189
Bsp143I GATC 3 cut(s) 69, 115, 357
BspANI GGCC 2 cut(s) 41, 189
BspPI GGATC 2 cut(s) 77, 123
BssECI CCNNGG 2 cut(s) 121, 122
BssMI GATC 3 cut(s) 69, 115, 357
Bst2UI CCWGG 1 cut(s) 123
Bst4CI ACNGT 2 cut(s) 194, 339
BstF5I GGATG 2 cut(s) 245, 299
BstKTI GATC 3 cut(s) 72, 118, 360
BstMBI GATC 3 cut(s) 69, 115, 357
BstMWI GCNNNNNNNGC 1 cut(s) 374
BstNI CCWGG 1 cut(s) 123
BstSCI CCNGG 2 cut(s) 121, 302
BstV1I GCAGC 2 cut(s) 333, 355
BsuRI GGCC 2 cut(s) 41, 189
BtgZI GCGATG 1 cut(s) 144
BtsCI GGATG 2 cut(s) 245, 299
BtsIMutI CAGTG 1 cut(s) 199
CaiI CAGNNNCTG 1 cut(s) 343
Cfr13I GGNCC 1 cut(s) 187
CviJI RGCY 7 cut(s) 5, 41, 189, 265, 277, 331, 368
CviKI_1 RGCY 7 cut(s) 5, 41, 189, 265, 277, 331, 368
DpnI GATC 3 cut(s) 71, 117, 359
DpnII GATC 3 cut(s) 69, 115, 357
EaeI YGGCCR 1 cut(s) 39
EcoRII CCWGG 1 cut(s) 121
FaiI YATR 4 cut(s) 74, 93, 228, 254
Fnu4HI GCNGC 2 cut(s) 347, 369
FokI GGATG 2 cut(s) 232, 286
Fsp4HI GCNGC 2 cut(s) 347, 369
GluI GCNGC 2 cut(s) 347, 369
HaeIII GGCC 2 cut(s) 41, 189
HapII CCGG 1 cut(s) 303
HincII GTYRAC 1 cut(s) 241
HindII GTYRAC 1 cut(s) 241
HindIII AAGCTT 1 cut(s) 275
HinfI GANTC 2 cut(s) 11, 197
HpaII CCGG 1 cut(s) 303
HphI GGTGA 2 cut(s) 91, 110
Hpy166II GTNNAC 1 cut(s) 241
Hpy188I TCNGA 1 cut(s) 10
Hpy188III TCNNGA 3 cut(s) 81, 154, 315
Hpy8I GTNNAC 1 cut(s) 241
HpyAV CCTTC 1 cut(s) 199
HpyCH4III ACNGT 2 cut(s) 194, 339
HpyCH4V TGCA 3 cut(s) 164, 371, 382
HpyF10VI GCNNNNNNNGC 1 cut(s) 374
Kzo9I GATC 3 cut(s) 69, 115, 357
LmnI GCTCC 1 cut(s) 208
LpnPI CCDG 8 cut(s) 52, 66, 108, 135, 270, 294, 300, 316
Lsp1109I GCAGC 2 cut(s) 333, 355
LweI GCATC 1 cut(s) 151
MaeIII GTNAC 3 cut(s) 97, 269, 333
MalI GATC 3 cut(s) 71, 117, 359
MboI GATC 3 cut(s) 69, 115, 357
MboII GAAGA 1 cut(s) 303
MlsI TGGCCA 1 cut(s) 41
MluCI AATT 1 cut(s) 221
MluNI TGGCCA 1 cut(s) 41
MnlI CCTC 3 cut(s) 28, 106, 306
Mox20I TGGCCA 1 cut(s) 41
MscI TGGCCA 1 cut(s) 41
MseI TTAA 1 cut(s) 177
MslI CAYNNNNRTG 1 cut(s) 30
Msp20I TGGCCA 1 cut(s) 41
MspI CCGG 1 cut(s) 303
MspR9I CCNGG 2 cut(s) 123, 304
MvaI CCWGG 1 cut(s) 123
MwoI GCNNNNNNNGC 1 cut(s) 374
NciI CCSGG 1 cut(s) 304
NdeII GATC 3 cut(s) 69, 115, 357
NmuCI GTSAC 1 cut(s) 97
PasI CCCWGGG 1 cut(s) 122
PfeI GAWTC 2 cut(s) 11, 197
PkrI GCNGC 2 cut(s) 348, 370
Psp6I CCWGG 1 cut(s) 121
PspGI CCWGG 1 cut(s) 121
PspPI GGNCC 1 cut(s) 187
PstNI CAGNNNCTG 1 cut(s) 343
RseI CAYNNNNRTG 1 cut(s) 30
SaqAI TTAA 1 cut(s) 177
SatI GCNGC 2 cut(s) 347, 369
Sau3AI GATC 3 cut(s) 69, 115, 357
Sau96I GGNCC 1 cut(s) 187
ScrFI CCNGG 2 cut(s) 123, 304
SetI ASST 5 cut(s) 39, 90, 240, 279, 333
SfaNI GCATC 1 cut(s) 151
SmiMI CAYNNNNRTG 1 cut(s) 30
SmlI CTYRAG 1 cut(s) 15
SmoI CTYRAG 1 cut(s) 15
Sse9I AATT 1 cut(s) 221
StyD4I CCNGG 2 cut(s) 121, 302
TaaI ACNGT 2 cut(s) 194, 339
TaqI TCGA 2 cut(s) 30, 153
TasI AATT 1 cut(s) 221
TfiI GAWTC 2 cut(s) 11, 197
Tru1I TTAA 1 cut(s) 177
Tru9I TTAA 1 cut(s) 177
TscAI CASTG 1 cut(s) 199
TseFI GTSAC 1 cut(s) 97
TseI GCWGC 2 cut(s) 346, 368
Tsp45I GTSAC 1 cut(s) 97
TspDTI ATGAA 1 cut(s) 147
TspRI CASTG 1 cut(s) 199
XapI RAATTY 1 cut(s) 221
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.