Rh1CG275400

cytochrome

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
54303899 .. 54305803
1905 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG275400.1

Sequence Viewer

Length: 408 bp
ATGGCTTCAGATTCTAAAGTCTATCACTTTGATGAGGTGGCACAGCACAAGTACAAGAAAGATTGCTGGATTATAGTCTCTGGAAAGGTTTATGATGTCACTCCTTTTCTGGAGGAACACCCTGGAGGTGATGAAGTCTTGCTATTAGCAGCTGATAGGGATGCAACTGATGATTTCAATGATGTTGGCCACAGCGATTCTGCAAAGGAGATGATGGAAAAGTACTACGTAGGCGAGGTTGACACATCCACAATACCAGAGCAGCCAAATTACAAGCTGCCTGCACAAGCAACAGCTCCTCAAGCTGACCAATCTTCTGGATTTGTGGTAAAACTTCTACAGTTTCTGCTGCCCTTGTTGATCTTGGGGGCTGCATTTGCTCTGCAATACTACAGTAAAAAGAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

135

Amino Acids

15.09

Weight (kDa)

4.83

Isoelectric Point (pI)

33.72

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cyt-b5 PF00173 11 - 80 9.9e-29 Cytochrome b5-like Heme/Steroid binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 187
AfaI GTAC 2 cut(s) 53, 224
AgsI TTSAA 1 cut(s) 178
AjnI CCWGG 1 cut(s) 121
AluBI AGCT 4 cut(s) 152, 277, 296, 305
AluI AGCT 4 cut(s) 152, 277, 296, 305
Alw26I GTCTC 1 cut(s) 82
AlwNI CAGNNNCTG 1 cut(s) 346
AoxI GGCC 1 cut(s) 187
ApeKI GCWGC 5 cut(s) 149, 262, 277, 349, 371
AsuHPI GGTGA 1 cut(s) 140
BalI TGGCCA 1 cut(s) 189
BbvI GCAGC 5 cut(s) 161, 264, 274, 336, 358
BccI CCATC 1 cut(s) 208
BciT130I CCWGG 1 cut(s) 123
BcoDI GTCTC 1 cut(s) 82
BfmI CTRYAG 2 cut(s) 338, 391
BisI GCNGC 5 cut(s) 150, 263, 278, 350, 372
BlsI GCNGC 5 cut(s) 151, 264, 279, 351, 373
BmcAI AGTACT 1 cut(s) 224
Bme1390I CCNGG 1 cut(s) 123
BmrFI CCNGG 1 cut(s) 123
BmsI GCATC 1 cut(s) 151
BpmI CTGGAG 2 cut(s) 131, 144
BpuEI CTTGAG 1 cut(s) 285
BsaAI YACGTR 1 cut(s) 229
BsaJI CCNNGG 1 cut(s) 121
BseBI CCWGG 1 cut(s) 123
BseDI CCNNGG 1 cut(s) 121
BseGI GGATG 2 cut(s) 166, 245
BseRI GAGGAG 1 cut(s) 288
BseXI GCAGC 5 cut(s) 161, 264, 274, 336, 358
BsgI GTGCAG 1 cut(s) 267
BshFI GGCC 1 cut(s) 189
BsmAI GTCTC 1 cut(s) 82
BsnI GGCC 1 cut(s) 189
Bsp143I GATC 1 cut(s) 360
BspANI GGCC 1 cut(s) 189
BssECI CCNNGG 1 cut(s) 121
BssMI GATC 1 cut(s) 360
Bst2UI CCWGG 1 cut(s) 123
Bst4CI ACNGT 2 cut(s) 342, 395
BstBAI YACGTR 1 cut(s) 229
BstC8I GCNNGC 1 cut(s) 282
BstF5I GGATG 2 cut(s) 166, 245
BstKTI GATC 1 cut(s) 363
BstMAI GTCTC 1 cut(s) 82
BstMBI GATC 1 cut(s) 360
BstMWI GCNNNNNNNGC 2 cut(s) 302, 377
BstNI CCWGG 1 cut(s) 123
BstSCI CCNGG 1 cut(s) 121
BstSFI CTRYAG 2 cut(s) 338, 391
BstSNI TACGTA 1 cut(s) 229
BstV1I GCAGC 5 cut(s) 161, 264, 274, 336, 358
BstXI CCANNNNNNTGG 1 cut(s) 317
BsuRI GGCC 1 cut(s) 189
BtsCI GGATG 2 cut(s) 166, 245
Cac8I GCNNGC 1 cut(s) 282
CaiI CAGNNNCTG 1 cut(s) 346
Csp6I GTAC 2 cut(s) 52, 223
CviJI RGCY 8 cut(s) 5, 152, 189, 265, 277, 296, 305, 371
CviKI_1 RGCY 8 cut(s) 5, 152, 189, 265, 277, 296, 305, 371
CviQI GTAC 2 cut(s) 52, 223
DpnI GATC 1 cut(s) 362
DpnII GATC 1 cut(s) 360
EaeI YGGCCR 1 cut(s) 187
Eco105I TACGTA 1 cut(s) 229
EcoRII CCWGG 1 cut(s) 121
FaiI YATR 2 cut(s) 74, 93
Fnu4HI GCNGC 5 cut(s) 150, 263, 278, 350, 372
FokI GGATG 2 cut(s) 173, 232
Fsp4HI GCNGC 5 cut(s) 150, 263, 278, 350, 372
GluI GCNGC 5 cut(s) 150, 263, 278, 350, 372
GsuI CTGGAG 2 cut(s) 131, 144
HaeIII GGCC 1 cut(s) 189
HincII GTYRAC 1 cut(s) 241
HindII GTYRAC 1 cut(s) 241
HinfI GANTC 2 cut(s) 11, 197
HphI GGTGA 1 cut(s) 140
Hpy166II GTNNAC 1 cut(s) 241
Hpy188I TCNGA 1 cut(s) 10
Hpy188III TCNNGA 3 cut(s) 81, 110, 318
Hpy8I GTNNAC 1 cut(s) 241
HpyCH4III ACNGT 2 cut(s) 342, 395
HpyCH4IV ACGT 1 cut(s) 228
HpyCH4V TGCA 5 cut(s) 164, 203, 284, 374, 385
HpyF10VI GCNNNNNNNGC 2 cut(s) 302, 377
HpySE526I ACGT 1 cut(s) 228
Kzo9I GATC 1 cut(s) 360
LmnI GCTCC 1 cut(s) 301
LpnPI CCDG 8 cut(s) 52, 66, 95, 108, 135, 270, 294, 303
Lsp1109I GCAGC 5 cut(s) 161, 264, 274, 336, 358
LweI GCATC 1 cut(s) 151
MaeII ACGT 1 cut(s) 228
MaeIII GTNAC 1 cut(s) 97
MalI GATC 1 cut(s) 362
MboI GATC 1 cut(s) 360
MboII GAAGA 1 cut(s) 306
MlsI TGGCCA 1 cut(s) 189
MluCI AATT 1 cut(s) 268
MluNI TGGCCA 1 cut(s) 189
MnlI CCTC 5 cut(s) 28, 106, 119, 229, 309
Mox20I TGGCCA 1 cut(s) 189
MscI TGGCCA 1 cut(s) 189
MslI CAYNNNNRTG 1 cut(s) 30
Msp20I TGGCCA 1 cut(s) 189
MspA1I CMGCKG 1 cut(s) 152
MspR9I CCNGG 1 cut(s) 123
MvaI CCWGG 1 cut(s) 123
MwoI GCNNNNNNNGC 2 cut(s) 302, 377
NdeII GATC 1 cut(s) 360
NmuCI GTSAC 1 cut(s) 97
PfeI GAWTC 2 cut(s) 11, 197
PkrI GCNGC 5 cut(s) 151, 264, 279, 351, 373
Ppu21I YACGTR 1 cut(s) 229
Psp6I CCWGG 1 cut(s) 121
PspGI CCWGG 1 cut(s) 121
PstNI CAGNNNCTG 1 cut(s) 346
PvuII CAGCTG 1 cut(s) 152
RsaI GTAC 2 cut(s) 53, 224
RsaNI GTAC 2 cut(s) 52, 223
RseI CAYNNNNRTG 1 cut(s) 30
SatI GCNGC 5 cut(s) 150, 263, 278, 350, 372
Sau3AI GATC 1 cut(s) 360
ScaI AGTACT 1 cut(s) 224
ScrFI CCNGG 1 cut(s) 123
SetI ASST 9 cut(s) 39, 90, 130, 154, 231, 240, 279, 298, 307
SfaNI GCATC 1 cut(s) 151
SfcI CTRYAG 2 cut(s) 338, 391
SmiMI CAYNNNNRTG 1 cut(s) 30
SmlI CTYRAG 1 cut(s) 300
SmoI CTYRAG 1 cut(s) 300
SnaBI TACGTA 1 cut(s) 229
Sse9I AATT 1 cut(s) 268
StyD4I CCNGG 1 cut(s) 121
TaaI ACNGT 2 cut(s) 342, 395
TaiI ACGT 1 cut(s) 231
TasI AATT 1 cut(s) 268
TatI WGTACW 2 cut(s) 51, 222
TfiI GAWTC 2 cut(s) 11, 197
TseFI GTSAC 1 cut(s) 97
TseI GCWGC 5 cut(s) 149, 262, 277, 349, 371
Tsp45I GTSAC 1 cut(s) 97
TspDTI ATGAA 1 cut(s) 147
ZrmI AGTACT 1 cut(s) 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.