Prupe.2G303700_v2.0.a1

SNAP receptor activity

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Forward (+)
29024581 .. 29025531
951 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G303700.1

Sequence Viewer

Length: 243 bp
ATGTCATCCATTTTTAGTCATGGAAATTCATCTATTCTGCAGGTTCTTGACCGCGGTGAGAAGATTGAGCTGTTGGTGGACAAAACTGATAATCTTCGCTCCCAGGCCCAAGATTTCAGGACACAGGGAACAAAAATGAAAAGGAAGATGTGGTTTCAGAATATGAAGATAAAATTGATTACTTGTGGAGATCATCATTCTCATAGACTTTGTGATATTTTTGTCAATCTGCCATGGTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

81

Amino Acids

9.42

Weight (kDa)

9.44

Isoelectric Point (pI)

45.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015867)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 31
AccII CGCG 1 cut(s) 54
AciI CCGC 2 cut(s) 52, 54
AcsI RAATTY 1 cut(s) 25
AjnI CCWGG 1 cut(s) 102
AluBI AGCT 1 cut(s) 70
AluI AGCT 1 cut(s) 70
AoxI GGCC 1 cut(s) 105
ApoI RAATTY 1 cut(s) 25
AspS9I GGNCC 1 cut(s) 106
AsuHPI GGTGA 1 cut(s) 68
BciT130I CCWGG 1 cut(s) 104
BfmI CTRYAG 1 cut(s) 38
BfuAI ACCTGC 1 cut(s) 31
Bme1390I CCNGG 1 cut(s) 104
BmgT120I GGNCC 1 cut(s) 106
BmrFI CCNGG 1 cut(s) 104
BsaJI CCNNGG 3 cut(s) 52, 102, 233
BseBI CCWGG 1 cut(s) 104
BseDI CCNNGG 3 cut(s) 52, 102, 233
BseGI GGATG 1 cut(s) 5
Bsh1236I CGCG 1 cut(s) 54
BshFI GGCC 1 cut(s) 107
BsnI GGCC 1 cut(s) 107
Bsp143I GATC 1 cut(s) 190
Bsp19I CCATGG 1 cut(s) 233
BspACI CCGC 2 cut(s) 52, 54
BspANI GGCC 1 cut(s) 107
BspFNI CGCG 1 cut(s) 54
BspMAI CTGCAG 1 cut(s) 42
BspMI ACCTGC 1 cut(s) 31
BssECI CCNNGG 3 cut(s) 52, 102, 233
BssMI GATC 1 cut(s) 190
BssT1I CCWWGG 1 cut(s) 233
Bst2UI CCWGG 1 cut(s) 104
BstDSI CCRYGG 2 cut(s) 52, 233
BstF5I GGATG 1 cut(s) 5
BstFNI CGCG 1 cut(s) 54
BstKTI GATC 1 cut(s) 193
BstMBI GATC 1 cut(s) 190
BstNI CCWGG 1 cut(s) 104
BstSCI CCNGG 1 cut(s) 102
BstSFI CTRYAG 1 cut(s) 38
BstUI CGCG 1 cut(s) 54
BsuRI GGCC 1 cut(s) 107
BtgI CCRYGG 2 cut(s) 52, 233
BtsCI GGATG 1 cut(s) 5
BveI ACCTGC 1 cut(s) 31
Cfr13I GGNCC 1 cut(s) 106
Cfr42I CCGCGG 1 cut(s) 55
CviAII CATG 2 cut(s) 20, 234
CviJI RGCY 2 cut(s) 70, 107
CviKI_1 RGCY 2 cut(s) 70, 107
DpnI GATC 1 cut(s) 192
DpnII GATC 1 cut(s) 190
Eco130I CCWWGG 1 cut(s) 233
EcoRII CCWGG 1 cut(s) 102
EcoT14I CCWWGG 1 cut(s) 233
ErhI CCWWGG 1 cut(s) 233
FaeI CATG 2 cut(s) 23, 237
FaiI YATR 4 cut(s) 21, 164, 204, 235
FatI CATG 2 cut(s) 19, 233
HaeIII GGCC 1 cut(s) 107
Hin1II CATG 2 cut(s) 23, 237
HphI GGTGA 1 cut(s) 68
Hpy166II GTNNAC 1 cut(s) 79
Hpy188I TCNGA 1 cut(s) 159
Hpy188III TCNNGA 2 cut(s) 47, 118
Hpy8I GTNNAC 1 cut(s) 79
HpyCH4V TGCA 1 cut(s) 40
Hsp92II CATG 2 cut(s) 23, 237
KspI CCGCGG 1 cut(s) 55
Kzo9I GATC 1 cut(s) 190
LmnI GCTCC 1 cut(s) 104
LpnPI CCDG 5 cut(s) 26, 89, 103, 110, 116
MalI GATC 1 cut(s) 192
MboI GATC 1 cut(s) 190
MboII GAAGA 4 cut(s) 73, 86, 157, 178
MluCI AATT 2 cut(s) 25, 173
MseI TTAA 1 cut(s) 241
MspA1I CMGCKG 1 cut(s) 54
MspR9I CCNGG 1 cut(s) 104
MvaI CCWGG 1 cut(s) 104
MvnI CGCG 1 cut(s) 54
NcoI CCATGG 1 cut(s) 233
NdeII GATC 1 cut(s) 190
NlaIII CATG 2 cut(s) 23, 237
Psp6I CCWGG 1 cut(s) 102
PspGI CCWGG 1 cut(s) 102
PspPI GGNCC 1 cut(s) 106
PstI CTGCAG 1 cut(s) 42
SacII CCGCGG 1 cut(s) 55
SaqAI TTAA 1 cut(s) 241
Sau3AI GATC 1 cut(s) 190
Sau96I GGNCC 1 cut(s) 106
ScrFI CCNGG 1 cut(s) 104
SetI ASST 2 cut(s) 45, 72
SfcI CTRYAG 1 cut(s) 38
Sfr303I CCGCGG 1 cut(s) 55
SgrBI CCGCGG 1 cut(s) 55
Sse9I AATT 2 cut(s) 25, 173
SsiI CCGC 2 cut(s) 52, 54
StyD4I CCNGG 1 cut(s) 102
StyI CCWWGG 1 cut(s) 233
TasI AATT 2 cut(s) 25, 173
Tru1I TTAA 1 cut(s) 241
Tru9I TTAA 1 cut(s) 241
TspDTI ATGAA 3 cut(s) 18, 152, 179
XapI RAATTY 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.