Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp07

Orthogroup ID

OG0016574

Physical Location & Seq

Genomic Coordinates Reverse (-)

668493 .. 672967

Gene Structure 4475 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.7G005900.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 696 bp

ATGGAGTTGGTAGCAGAAAAGGAGTCTGACCAGCAGAACAACAACAACAACAGTGAGAAGAACAACAATACTAGTTATGCACAAGCACTTGTAGATTCTCATGAATCCGATGAATTTCGTGAACGTCAAGCTCGCGACCTCAAAGCTGGCCTCCATCCCCTCAAGCACAAATTCGTGTTTTGGTACACTCGTCGAACACTAGGAATGCGAAGTCAGACACCGTATGAGGACAATATAAAGAAAATTGTTGACTTCACTACGGTTGAAGCCTTTTGGGTGTGCTATTGCCACCTAGCCCGTCCTGCTACTTTGCCTAGCCCAACAGACTTGCATCTTTTCAAGGATGGAATTCGCCCTCTCTGGGAGGACTCTGCTAATTGCCATGGTGGTAAATGGATAATACGATTCAAAAAGGCTGTGTCGGGCCGTTTTTGGGAGGACCTGGTTCTTGCCTTGGTGGGTGACCAACTTGATTATGGAGAGAACATATGTGGTGCGGTACTAAGCATTAGATTCAATGAGGACATTTTGAGTGTCTGGAATCGCAATGCTTCTGATCATCAGGCTGTAATGGCTTTAAGAGATGCAATCAAGAGGAACCTGAAGCTTCCACACAGCTATCTCATGGAATACAAGCCACATGATGCTTCACTGCGTGACAATTCATCATACAGAAACACATGGTTGAGGGGTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko01521 ko03013 ko04066 ko04150 ko04151 ko04211 ko04910 map01521 map03013 map04066 map04150 map04151 map04211 map04910

Pfam Domains

Protein Families

IF4E

Protein Analysis

232

Amino Acids

26.84

Weight (kDa)

7.12

Isoelectric Point (pI)

37.34

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016574)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G18110
fragaria_vesca	FvH4_1g28260
malus_domestica	MD12G1004900.v1.1 MD14G1003400.v1.1
prunus_persica	Prupe.7G005900_v2.0.a1
pyrus_communis	pycom12g00400 pycom14g00140
rosa_chinensis	RchiOBHm_Chr3g0496901
rosa_laevigata	RLG00000022491
rosa_roxburghii	Rroxscaffold_6G00388600
rosa_rugosa	Rorug03G0288400
rosa_samantha	Rh3AG332300 Rh3DG368300
rosa_wichuraiana	Rw3G029190

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	135
AciI	CCGC	1 cut(s)	497
AcsI	RAATTY	3 cut(s)	113, 170, 348
AcuI	CTGAAG	1 cut(s)	623
AdeI	CACNNNGTG	1 cut(s)	656
AfaI	GTAC	2 cut(s)	185, 501
AfiI	CCNNNNNNNGG	2 cut(s)	361, 433
AgsI	TTSAA	4 cut(s)	266, 340, 409, 517
AhlI	ACTAGT	1 cut(s)	71
AjnI	CCWGG	1 cut(s)	441
AluBI	AGCT	4 cut(s)	131, 146, 607, 618
AluI	AGCT	4 cut(s)	131, 146, 607, 618
AoxI	GGCC	2 cut(s)	148, 424
ApoI	RAATTY	3 cut(s)	113, 170, 348
AspS9I	GGNCC	2 cut(s)	424, 439
AsuHPI	GGTGA	1 cut(s)	473
AvaII	GGWCC	1 cut(s)	439
BaeI	ACNNNNGTAYC	2 cut(s)	175, 208
BccI	CCATC	2 cut(s)	162, 338
BceAI	ACGGC	1 cut(s)	411
BciT130I	CCWGG	1 cut(s)	443
BclI	TGATCA	1 cut(s)	556
BcuI	ACTAGT	1 cut(s)	71
BfaI	CTAG	4 cut(s)	72, 200, 293, 315
Bme1390I	CCNGG	1 cut(s)	443
Bme18I	GGWCC	1 cut(s)	439
BmgT120I	GGNCC	2 cut(s)	424, 439
BmiI	GGNNCC	1 cut(s)	599
BmrFI	CCNGG	1 cut(s)	443
BmsI	GCATC	3 cut(s)	340, 574, 634
BpuEI	CTTGAG	1 cut(s)	146
BsaJI	CCNNGG	2 cut(s)	382, 453
Bsc4I	CCNNNNNNNGG	2 cut(s)	361, 433
Bse3DI	GCAATG	1 cut(s)	553
BseBI	CCWGG	1 cut(s)	443
BseDI	CCNNGG	2 cut(s)	382, 453
BseGI	GGATG	2 cut(s)	154, 349
BseLI	CCNNNNNNNGG	2 cut(s)	361, 433
BseMI	GCAATG	1 cut(s)	553
Bsh1236I	CGCG	1 cut(s)	135
BshFI	GGCC	2 cut(s)	150, 426
BslI	CCNNNNNNNGG	2 cut(s)	361, 433
BsmI	GAATGC	1 cut(s)	210
BsnI	GGCC	2 cut(s)	150, 426
Bsp143I	GATC	1 cut(s)	556
Bsp19I	CCATGG	1 cut(s)	382
Bsp68I	TCGCGA	1 cut(s)	135
BspACI	CCGC	1 cut(s)	497
BspANI	GGCC	2 cut(s)	150, 426
BspFNI	CGCG	1 cut(s)	135
BspHI	TCATGA	1 cut(s)	100
BspLI	GGNNCC	1 cut(s)	599
BsrDI	GCAATG	1 cut(s)	553
BssECI	CCNNGG	2 cut(s)	382, 453
BssMI	GATC	1 cut(s)	556
BssT1I	CCWWGG	2 cut(s)	382, 453
Bst2UI	CCWGG	1 cut(s)	443
Bst4CI	ACNGT	3 cut(s)	53, 222, 262
BstC8I	GCNNGC	2 cut(s)	133, 148
BstDEI	CTNAG	1 cut(s)	503
BstDSI	CCRYGG	1 cut(s)	382
BstEII	GGTNACC	1 cut(s)	461
BstF5I	GGATG	2 cut(s)	154, 349
BstFNI	CGCG	1 cut(s)	135
BstKTI	GATC	1 cut(s)	559
BstMBI	GATC	1 cut(s)	556
BstMWI	GCNNNNNNNGC	2 cut(s)	302, 572
BstNI	CCWGG	1 cut(s)	443
BstPI	GGTNACC	1 cut(s)	461
BstSCI	CCNGG	1 cut(s)	441
BstUI	CGCG	1 cut(s)	135
BsuRI	GGCC	2 cut(s)	150, 426
BtgI	CCRYGG	1 cut(s)	382
BtsCI	GGATG	2 cut(s)	154, 349
BtsI	GCAGTG	1 cut(s)	650
BtsIMutI	CAGTG	2 cut(s)	58, 650
BtuMI	TCGCGA	1 cut(s)	135
Cac8I	GCNNGC	2 cut(s)	133, 148
CciI	TCATGA	1 cut(s)	100
Cfr13I	GGNCC	2 cut(s)	424, 439
CsiI	ACCWGGT	1 cut(s)	441
Csp6I	GTAC	2 cut(s)	184, 500
CviAII	CATG	5 cut(s)	101, 383, 625, 641, 681
CviQI	GTAC	2 cut(s)	184, 500
DdeI	CTNAG	1 cut(s)	503
DpnI	GATC	1 cut(s)	558
DpnII	GATC	1 cut(s)	556
DraIII	CACNNNGTG	1 cut(s)	656
Eco130I	CCWWGG	2 cut(s)	382, 453
Eco47I	GGWCC	1 cut(s)	439
Eco57I	CTGAAG	1 cut(s)	623
Eco91I	GGTNACC	1 cut(s)	461
EcoO109I	RGGNCCY	1 cut(s)	439
EcoO65I	GGTNACC	1 cut(s)	461
EcoRI	GAATTC	1 cut(s)	348
EcoRII	CCWGG	1 cut(s)	441
EcoT14I	CCWWGG	2 cut(s)	382, 453
ErhI	CCWWGG	2 cut(s)	382, 453
FaeI	CATG	5 cut(s)	104, 386, 628, 644, 684
FatI	CATG	5 cut(s)	100, 382, 624, 640, 680
FauNDI	CATATG	1 cut(s)	488
FbaI	TGATCA	1 cut(s)	556
FokI	GGATG	2 cut(s)	141, 356
FspBI	CTAG	4 cut(s)	72, 200, 293, 315
HaeIII	GGCC	2 cut(s)	150, 426
Hin1II	CATG	5 cut(s)	104, 386, 628, 644, 684
HincII	GTYRAC	1 cut(s)	250
HindII	GTYRAC	1 cut(s)	250
HindIII	AAGCTT	1 cut(s)	605
HinfI	GANTC	7 cut(s)	23, 95, 104, 368, 405, 513, 541
HphI	GGTGA	1 cut(s)	473
Hpy166II	GTNNAC	3 cut(s)	122, 186, 250
Hpy188I	TCNGA	4 cut(s)	28, 109, 216, 556
Hpy188III	TCNNGA	5 cut(s)	101, 119, 134, 538, 592
Hpy8I	GTNNAC	3 cut(s)	122, 186, 250
Hpy99I	CGWCG	1 cut(s)	195
HpyCH4III	ACNGT	3 cut(s)	53, 222, 262
HpyCH4IV	ACGT	1 cut(s)	124
HpyCH4V	TGCA	3 cut(s)	80, 331, 587
HpyF10VI	GCNNNNNNNGC	2 cut(s)	302, 572
HpyF3I	CTNAG	1 cut(s)	503
HpySE526I	ACGT	1 cut(s)	124
Hsp92II	CATG	5 cut(s)	104, 386, 628, 644, 684
Ksp22I	TGATCA	1 cut(s)	556
Kzo9I	GATC	1 cut(s)	556
LpnPI	CCDG	9 cut(s)	44, 132, 315, 346, 428, 455, 523, 548, 614
LweI	GCATC	3 cut(s)	340, 574, 634
MabI	ACCWGGT	1 cut(s)	441
MaeI	CTAG	4 cut(s)	72, 200, 293, 315
MaeII	ACGT	1 cut(s)	124
MaeIII	GTNAC	2 cut(s)	461, 656
MalI	GATC	1 cut(s)	558
MboI	GATC	1 cut(s)	556
MboII	GAAGA	1 cut(s)	70
MluCI	AATT	6 cut(s)	113, 170, 243, 348, 376, 661
MlyI	GAGTC	2 cut(s)	32, 362
MseI	TTAA	1 cut(s)	578
MspR9I	CCNGG	1 cut(s)	443
Mva1269I	GAATGC	1 cut(s)	210
MvaI	CCWGG	1 cut(s)	443
MvnI	CGCG	1 cut(s)	135
MwoI	GCNNNNNNNGC	2 cut(s)	302, 572
NcoI	CCATGG	1 cut(s)	382
NdeI	CATATG	1 cut(s)	488
NdeII	GATC	1 cut(s)	556
NlaIII	CATG	5 cut(s)	104, 386, 628, 644, 684
NlaIV	GGNNCC	1 cut(s)	599
NmuCI	GTSAC	2 cut(s)	461, 656
NruI	TCGCGA	1 cut(s)	135
PagI	TCATGA	1 cut(s)	100
PctI	GAATGC	1 cut(s)	210
PfeI	GAWTC	5 cut(s)	95, 104, 405, 513, 541
PleI	GAGTC	2 cut(s)	31, 362
PpsI	GAGTC	2 cut(s)	31, 362
PpuMI	RGGWCCY	1 cut(s)	439
Psp5II	RGGWCCY	1 cut(s)	439
Psp6I	CCWGG	1 cut(s)	441
PspEI	GGTNACC	1 cut(s)	461
PspGI	CCWGG	1 cut(s)	441
PspN4I	GGNNCC	1 cut(s)	599
PspPI	GGNCC	2 cut(s)	424, 439
PspPPI	RGGWCCY	1 cut(s)	439
RruI	TCGCGA	1 cut(s)	135
RsaI	GTAC	2 cut(s)	185, 501
RsaNI	GTAC	2 cut(s)	184, 500
SaqAI	TTAA	1 cut(s)	578
Sau3AI	GATC	1 cut(s)	556
Sau96I	GGNCC	2 cut(s)	424, 439
SchI	GAGTC	2 cut(s)	32, 362
ScrFI	CCNGG	1 cut(s)	443
SetI	ASST	9 cut(s)	127, 133, 141, 148, 294, 444, 603, 609, 620
SexAI	ACCWGGT	1 cut(s)	441
SfaNI	GCATC	3 cut(s)	340, 574, 634
SinI	GGWCC	1 cut(s)	439
SmlI	CTYRAG	1 cut(s)	161
SmoI	CTYRAG	1 cut(s)	161
SpeI	ACTAGT	1 cut(s)	71
Sse9I	AATT	6 cut(s)	113, 170, 243, 348, 376, 661
SsiI	CCGC	1 cut(s)	497
SspMI	CTAG	4 cut(s)	72, 200, 293, 315
StyD4I	CCNGG	1 cut(s)	441
StyI	CCWWGG	2 cut(s)	382, 453
TaaI	ACNGT	3 cut(s)	53, 222, 262
TaiI	ACGT	1 cut(s)	127
TaqI	TCGA	1 cut(s)	193
TasI	AATT	6 cut(s)	113, 170, 243, 348, 376, 661
TfiI	GAWTC	5 cut(s)	95, 104, 405, 513, 541
Tru1I	TTAA	1 cut(s)	578
Tru9I	TTAA	1 cut(s)	578
TscAI	CASTG	2 cut(s)	58, 657
TseFI	GTSAC	2 cut(s)	461, 656
Tsp45I	GTSAC	2 cut(s)	461, 656
TspDTI	ATGAA	3 cut(s)	117, 126, 654
TspRI	CASTG	2 cut(s)	58, 657
VpaK11BI	GGWCC	1 cut(s)	439
XapI	RAATTY	3 cut(s)	113, 170, 348
XcmI	CCANNNNNNNNNTGG	1 cut(s)	473
XspI	CTAG	4 cut(s)	72, 200, 293, 315

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.