Prupe.8G004800_v2.0.a1

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Forward (+)
386347 .. 386556
210 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G004800.1

Sequence Viewer

Length: 210 bp
ATGACACCAAAATTTGACTATGTGGTGTGTTCGATTGAAGCATCAAAAGATCTTGATAATCTCTCTATTGATGAGCTACAAAGCAGTCTTCTGGTACATGAACAACGGATGAATGGCCATGCAATGGAAGAACAAGCATGGAAGGTGGCCATGCAAAAGATCTTGTATTCATATCATATGATTTTGGATTTAATTAAATTTGCATTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

8.07

Weight (kDa)

5.1

Isoelectric Point (pI)

42.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017469)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 124
AcoI YGGCCR 2 cut(s) 115, 147
AcsI RAATTY 2 cut(s) 11, 197
AfaI GTAC 1 cut(s) 96
AfiI CCNNNNNNNGG 1 cut(s) 124
AgsI TTSAA 1 cut(s) 38
AluBI AGCT 1 cut(s) 76
AluI AGCT 1 cut(s) 76
AoxI GGCC 2 cut(s) 115, 147
ApoI RAATTY 2 cut(s) 11, 197
BalI TGGCCA 2 cut(s) 117, 149
BbsI GAAGAC 1 cut(s) 80
BglII AGATCT 2 cut(s) 49, 159
BmsI GCATC 1 cut(s) 50
BpiI GAAGAC 1 cut(s) 80
Bsc4I CCNNNNNNNGG 1 cut(s) 124
Bse3DI GCAATG 1 cut(s) 129
BseGI GGATG 1 cut(s) 114
BseLI CCNNNNNNNGG 1 cut(s) 124
BseMI GCAATG 1 cut(s) 129
BshFI GGCC 2 cut(s) 117, 149
BslI CCNNNNNNNGG 1 cut(s) 124
BsnI GGCC 2 cut(s) 117, 149
Bsp143I GATC 2 cut(s) 49, 159
BspANI GGCC 2 cut(s) 117, 149
BsrDI GCAATG 1 cut(s) 129
BssMI GATC 2 cut(s) 49, 159
BstF5I GGATG 1 cut(s) 114
BstKTI GATC 2 cut(s) 52, 162
BstMBI GATC 2 cut(s) 49, 159
BstV2I GAAGAC 1 cut(s) 80
BstX2I RGATCY 2 cut(s) 49, 159
BstYI RGATCY 2 cut(s) 49, 159
BsuRI GGCC 2 cut(s) 117, 149
BtsCI GGATG 1 cut(s) 114
Csp6I GTAC 1 cut(s) 95
CviAII CATG 4 cut(s) 98, 119, 138, 151
CviJI RGCY 3 cut(s) 76, 117, 149
CviKI_1 RGCY 3 cut(s) 76, 117, 149
CviQI GTAC 1 cut(s) 95
DpnI GATC 2 cut(s) 51, 161
DpnII GATC 2 cut(s) 49, 159
EaeI YGGCCR 2 cut(s) 115, 147
FaeI CATG 4 cut(s) 101, 122, 141, 154
FaiI YATR 8 cut(s) 21, 99, 120, 139, 152, 172, 177, 179
FatI CATG 4 cut(s) 97, 118, 137, 150
FauNDI CATATG 1 cut(s) 177
FokI GGATG 1 cut(s) 121
HaeIII GGCC 2 cut(s) 117, 149
Hin1II CATG 4 cut(s) 101, 122, 141, 154
Hpy188III TCNNGA 1 cut(s) 53
HpyAV CCTTC 1 cut(s) 136
HpyCH4V TGCA 3 cut(s) 122, 154, 203
Hsp92II CATG 4 cut(s) 101, 122, 141, 154
Kzo9I GATC 2 cut(s) 49, 159
LpnPI CCDG 1 cut(s) 77
LweI GCATC 1 cut(s) 50
MalI GATC 2 cut(s) 51, 161
MboI GATC 2 cut(s) 49, 159
MboII GAAGA 2 cut(s) 80, 140
MflI RGATCY 2 cut(s) 49, 159
MlsI TGGCCA 2 cut(s) 117, 149
MluCI AATT 3 cut(s) 11, 192, 197
MluNI TGGCCA 2 cut(s) 117, 149
Mox20I TGGCCA 2 cut(s) 117, 149
MscI TGGCCA 2 cut(s) 117, 149
MseI TTAA 2 cut(s) 191, 195
Msp20I TGGCCA 2 cut(s) 117, 149
NdeI CATATG 1 cut(s) 177
NdeII GATC 2 cut(s) 49, 159
NlaIII CATG 4 cut(s) 101, 122, 141, 154
PacI TTAATTAA 1 cut(s) 195
PflMI CCANNNNNTGG 1 cut(s) 124
PsuI RGATCY 2 cut(s) 49, 159
RsaI GTAC 1 cut(s) 96
RsaNI GTAC 1 cut(s) 95
SaqAI TTAA 2 cut(s) 191, 195
Sau3AI GATC 2 cut(s) 49, 159
SetI ASST 2 cut(s) 78, 147
SfaNI GCATC 1 cut(s) 50
SgeI CNNG 8 cut(s) 65, 104, 110, 131, 146, 150, 163, 175
Sse9I AATT 3 cut(s) 11, 192, 197
TaqI TCGA 1 cut(s) 32
TasI AATT 3 cut(s) 11, 192, 197
Tru1I TTAA 2 cut(s) 191, 195
Tru9I TTAA 2 cut(s) 191, 195
TspDTI ATGAA 3 cut(s) 114, 125, 159
TspGWI ACGGA 1 cut(s) 121
Van91I CCANNNNNTGG 1 cut(s) 124
XapI RAATTY 2 cut(s) 11, 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.