pycom420g01040

fructose-bisphosphate aldolase

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_420
Physical Location & Seq
Reverse (-)
1524115 .. 1524481
367 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom420g01040.1

Sequence Viewer

Length: 225 bp
ATGAATAATACATGGATAATTGATTATGGTGCTACTGAACATATGATTTGTGATTCTAGACAGGTACAAACTCTAAAACCATTTACCAAAATTGTCGTGACTATTGCCAATGGCAATGTTGCCTTTGTTATTAGGGAAGGTTTCAAACTGAAAAGACGATTGATGATGGTATTTAAAAGGGGAAGCTTTACTACTTGGAGTTGTCTAACAGTACCTAGATGTTGA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.57

Weight (kDa)

10.05

Isoelectric Point (pI)

24.4

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pol_BBD PF22936 5 - 45 7.1e-06 Pol polyprotein, beta-barrel domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017469)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 66, 213
AgsI TTSAA 1 cut(s) 145
AluBI AGCT 1 cut(s) 186
AluI AGCT 1 cut(s) 186
BarI GAAGNNNNNNTAC 2 cut(s) 175, 207
BccI CCATC 1 cut(s) 160
BfaI CTAG 2 cut(s) 57, 216
Bse3DI GCAATG 1 cut(s) 121
BseMI GCAATG 1 cut(s) 121
BsrDI GCAATG 1 cut(s) 121
Bst4CI ACNGT 1 cut(s) 211
Csp6I GTAC 2 cut(s) 65, 212
CviAII CATG 1 cut(s) 12
CviJI RGCY 1 cut(s) 186
CviKI_1 RGCY 1 cut(s) 186
CviQI GTAC 2 cut(s) 65, 212
DraI TTTAAA 1 cut(s) 175
FaeI CATG 1 cut(s) 15
FaiI YATR 4 cut(s) 13, 27, 42, 44
FatI CATG 1 cut(s) 11
FauNDI CATATG 1 cut(s) 42
FspBI CTAG 2 cut(s) 57, 216
Hin1II CATG 1 cut(s) 15
HindIII AAGCTT 1 cut(s) 184
HinfI GANTC 1 cut(s) 53
Hpy188III TCNNGA 2 cut(s) 57, 97
HpyAV CCTTC 1 cut(s) 131
HpyCH4III ACNGT 1 cut(s) 211
Hsp92II CATG 1 cut(s) 15
LpnPI CCDG 1 cut(s) 47
MaeI CTAG 2 cut(s) 57, 216
MaeIII GTNAC 1 cut(s) 97
MluCI AATT 2 cut(s) 18, 90
MseI TTAA 1 cut(s) 174
NdeI CATATG 1 cut(s) 42
NlaIII CATG 1 cut(s) 15
NmuCI GTSAC 1 cut(s) 97
PfeI GAWTC 1 cut(s) 53
RsaI GTAC 2 cut(s) 66, 213
RsaNI GTAC 2 cut(s) 65, 212
SaqAI TTAA 1 cut(s) 174
SetI ASST 4 cut(s) 66, 142, 188, 217
SgeI CNNG 5 cut(s) 24, 69, 74, 109, 207
Sse9I AATT 2 cut(s) 18, 90
SspMI CTAG 2 cut(s) 57, 216
TaaI ACNGT 1 cut(s) 211
TasI AATT 2 cut(s) 18, 90
TfiI GAWTC 1 cut(s) 53
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TseFI GTSAC 1 cut(s) 97
Tsp45I GTSAC 1 cut(s) 97
TspDTI ATGAA 1 cut(s) 17
XbaI TCTAGA 1 cut(s) 56
XspI CTAG 2 cut(s) 57, 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.