Prupe.8G109100_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Reverse (-)
13917406 .. 13917963
558 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G109100.1

Sequence Viewer

Length: 207 bp
ATGCCTTTCTGTCAGGGACTACCACAGCAACAAGAAACGACTCAAAGCTGTTCCCATAAACCCAAATCTGCAAACCAGAGGAAAGTTCAGATATCCACAACTTTAGAAAACAGGAAAACAACCAAAAGGAAATTTTCACAAATTAAACCAAAAATACAAACTCGTCAATGGAGGAAAACAGAGGCGAGTCCTAATGTATGGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

8.01

Weight (kDa)

10.83

Isoelectric Point (pI)

58.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015020)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G78600 AT1G78600
fragaria_vesca FvH4_6g37790
malus_domestica MD09G1155900.v1.1
prunus_persica Prupe.8G109100_v2.0.a1
pyrus_communis pycom09g07470
rosa_chinensis RchiOBHm_Chr2g0150861
rosa_laevigata RLG00000020514
rosa_multiflora Rmu_sc0000185.1_g000012 Rmu_sc0007617.1_g000006
rosa_rugosa Rorug02G0423000
rosa_samantha Rh2AG483300 Rh2BG495700 Rh2CG469600 Rh2DG506600
rosa_wichuraiana Rw2G039610

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 131
AluBI AGCT 1 cut(s) 48
AluI AGCT 1 cut(s) 48
ApoI RAATTY 1 cut(s) 131
BslFI GGGAC 1 cut(s) 30
BsmFI GGGAC 1 cut(s) 30
CviJI RGCY 1 cut(s) 48
CviKI_1 RGCY 1 cut(s) 48
Eco32I GATATC 1 cut(s) 93
EcoRV GATATC 1 cut(s) 93
FaiI YATR 2 cut(s) 57, 199
FaqI GGGAC 1 cut(s) 30
HinfI GANTC 2 cut(s) 40, 187
Hpy188I TCNGA 1 cut(s) 90
HpyCH4V TGCA 1 cut(s) 71
LpnPI CCDG 2 cut(s) 89, 97
MluCI AATT 2 cut(s) 131, 141
MlyI GAGTC 2 cut(s) 34, 196
MnlI CCTC 3 cut(s) 72, 165, 175
MseI TTAA 1 cut(s) 144
PleI GAGTC 2 cut(s) 34, 195
PpsI GAGTC 2 cut(s) 34, 195
SaqAI TTAA 1 cut(s) 144
SchI GAGTC 2 cut(s) 34, 196
SetI ASST 1 cut(s) 50
SgeI CNNG 6 cut(s) 26, 44, 88, 124, 174, 198
Sse9I AATT 2 cut(s) 131, 141
TasI AATT 2 cut(s) 131, 141
Tru1I TTAA 1 cut(s) 144
Tru9I TTAA 1 cut(s) 144
XapI RAATTY 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.