Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp08

Orthogroup ID

OG0012663

Physical Location & Seq

Genomic Coordinates Forward (+)

14256030 .. 14257179

Gene Structure 1150 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.8G115300.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 705 bp

ATGAAGTCATCTGGTCACAATGTCACAGCCCTAGACCTAGCTGCTTCTGGGGTTGACCCTCAGCAGGCAAAAGATCTGCAATCAATTTCTGACTACTTCAAGCCCTTGACGAATTTCATGGCAGCTCTTGATCCTCCACATGATAAGGTCATCCTTGTTGGTCACAGTCTTGGTGGGTTGGCCATTTCTTATGCCATGGAAAGATTTCTAGATAAGATATCTCTAGTTGTTTTCATCACTGCCTTAATGCCTGGCCCGACCCTCAACATCTCCACTCTTAATCAAGAGTCGTTCAGAAGACAAAGATCTCTATTAGACAGCAAATACACATATGACCAAGGCCCAAACTATCCTCCAATCACTCTCACATTCGGCCCATTGTTCTTGGCAACAAACGTGTACCAACTCAGCCCAACTGAGGATTTAGCACTAGGCACCATGTTAATGAGACCTCAACGCTTGTTTAGTGAAGAGGACCTGTCCAAAGAACTCAAGCTAACCCGTGAGAAATACGGGTCGGTCAATCGGGTTTATGTCTTATCCGGCGGAGATTTGTTGACGGAGAAGGATCTCCAACGGTGGATGATTAAGAGGAACAGGCCAAACGGTGTGGTGGAAATCACAGGATCTGATCACATGGTCATGATTTCTAAGCCATTAGAGCTGTGGGTGCATATCCAAAGAATTTCTGAGAAATATTCCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Abhydrolase_1 Abhydrolase_6

Protein Analysis

235

Amino Acids

26.33

Weight (kDa)

6.98

Isoelectric Point (pI)

45.51

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012663)

Species	Orthologous Gene IDs
malus_domestica	MD05G1074300.v1.1
prunus_persica	Prupe.8G114700_v2.0.a1 Prupe.8G115000_v2.0.a1 Prupe.8G115300_v2.0.a1
pyrus_communis	pycom05g06700
rosa_chinensis	RchiOBHm_Chr4g0407461 RchiOBHm_Chr6g0259411 RchiOBHm_Chr6g0259431
rosa_laevigata	RLG00000014534
rosa_multiflora	Rmu_sc0006836.1_g000015 Rmu_ssc0000050.1_g000045
rosa_roxburghii	Rroxscaffold_7G00206700
rosa_rugosa	Rorug05G0588800 Rorug06G0097000
rosa_samantha	Rh6AG104500 Rh6BG097700 Rh6CG093600 Rh6DG087500
rosa_wichuraiana	Rw6G009030

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	434
AciI	CCGC	1 cut(s)	546
AclWI	GGATC	3 cut(s)	125, 576, 634
AcoI	YGGCCR	1 cut(s)	180
AcsI	RAATTY	2 cut(s)	112, 684
AfaI	GTAC	1 cut(s)	401
AfiI	CCNNNNNNNGG	2 cut(s)	64, 418
AflIII	ACRYGT	1 cut(s)	396
AgsI	TTSAA	1 cut(s)	100
AjnI	CCWGG	1 cut(s)	250
AluBI	AGCT	4 cut(s)	41, 125, 496, 664
AluI	AGCT	4 cut(s)	41, 125, 496, 664
Alw26I	GTCTC	1 cut(s)	442
AlwI	GGATC	3 cut(s)	125, 576, 634
AlwNI	CAGNNNCTG	1 cut(s)	629
AoxI	GGCC	5 cut(s)	180, 253, 340, 373, 599
ApeKI	GCWGC	2 cut(s)	41, 122
ApoI	RAATTY	2 cut(s)	112, 684
Asp700I	GAANNNNTTC	1 cut(s)	204
AspS9I	GGNCC	4 cut(s)	254, 341, 374, 475
AvaII	GGWCC	1 cut(s)	475
BalI	TGGCCA	1 cut(s)	182
BanI	GGYRCC	1 cut(s)	434
BbsI	GAAGAC	1 cut(s)	304
BbvCI	CCTCAGC	1 cut(s)	60
BbvI	GCAGC	2 cut(s)	28, 134
BciT130I	CCWGG	1 cut(s)	252
BclI	TGATCA	1 cut(s)	631
BcoDI	GTCTC	1 cut(s)	442
BfaI	CTAG	5 cut(s)	32, 38, 209, 224, 431
BglII	AGATCT	2 cut(s)	73, 305
BisI	GCNGC	2 cut(s)	42, 123
BlsI	GCNGC	2 cut(s)	43, 124
Bme1390I	CCNGG	1 cut(s)	252
Bme18I	GGWCC	1 cut(s)	475
BmgT120I	GGNCC	4 cut(s)	254, 341, 374, 475
BmiI	GGNNCC	1 cut(s)	436
BmrFI	CCNGG	1 cut(s)	252
BpiI	GAAGAC	1 cut(s)	304
Bpu10I	CCTNAGC	1 cut(s)	60
BpuEI	CTTGAG	1 cut(s)	476
BsaI	GGTCTC	1 cut(s)	442
BsaJI	CCNNGG	2 cut(s)	195, 337
Bsc4I	CCNNNNNNNGG	2 cut(s)	64, 418
BseBI	CCWGG	1 cut(s)	252
BseDI	CCNNGG	2 cut(s)	195, 337
BseGI	GGATG	2 cut(s)	150, 588
BseLI	CCNNNNNNNGG	2 cut(s)	64, 418
BseMII	CTCAG	4 cut(s)	74, 408, 421, 681
BseXI	GCAGC	2 cut(s)	28, 134
BshFI	GGCC	5 cut(s)	182, 255, 342, 375, 601
BshNI	GGYRCC	1 cut(s)	434
BsiSI	CCGG	1 cut(s)	543
BslI	CCNNNNNNNGG	2 cut(s)	64, 418
BsmAI	GTCTC	1 cut(s)	442
BsnI	GGCC	5 cut(s)	182, 255, 342, 375, 601
Bso31I	GGTCTC	1 cut(s)	442
Bsp143I	GATC	6 cut(s)	73, 130, 305, 568, 626, 631
Bsp19I	CCATGG	1 cut(s)	195
BspACI	CCGC	1 cut(s)	546
BspANI	GGCC	5 cut(s)	182, 255, 342, 375, 601
BspCNI	CTCAG	4 cut(s)	73, 409, 420, 682
BspHI	TCATGA	1 cut(s)	642
BspLI	GGNNCC	1 cut(s)	436
BspPI	GGATC	3 cut(s)	125, 576, 634
BspT107I	GGYRCC	1 cut(s)	434
BspTNI	GGTCTC	1 cut(s)	442
BssECI	CCNNGG	2 cut(s)	195, 337
BssMI	GATC	6 cut(s)	73, 130, 305, 568, 626, 631
BssT1I	CCWWGG	2 cut(s)	195, 337
Bst2UI	CCWGG	1 cut(s)	252
Bst4CI	ACNGT	3 cut(s)	167, 579, 608
Bst6I	CTCTTC	1 cut(s)	465
BstC8I	GCNNGC	1 cut(s)	66
BstDEI	CTNAG	5 cut(s)	60, 407, 417, 651, 690
BstDSI	CCRYGG	1 cut(s)	195
BstF5I	GGATG	2 cut(s)	150, 588
BstKTI	GATC	6 cut(s)	76, 133, 308, 571, 629, 634
BstMAI	GTCTC	1 cut(s)	442
BstMBI	GATC	6 cut(s)	73, 130, 305, 568, 626, 631
BstMWI	GCNNNNNNNGC	2 cut(s)	661, 670
BstNI	CCWGG	1 cut(s)	252
BstSCI	CCNGG	1 cut(s)	250
BstV1I	GCAGC	2 cut(s)	28, 134
BstV2I	GAAGAC	1 cut(s)	304
BstX2I	RGATCY	4 cut(s)	73, 305, 568, 626
BstYI	RGATCY	4 cut(s)	73, 305, 568, 626
BsuRI	GGCC	5 cut(s)	182, 255, 342, 375, 601
BtgI	CCRYGG	1 cut(s)	195
BtsCI	GGATG	2 cut(s)	150, 588
BtsI	GCAGTG	1 cut(s)	237
BtsIMutI	CAGTG	1 cut(s)	237
Cac8I	GCNNGC	1 cut(s)	66
CaiI	CAGNNNCTG	1 cut(s)	629
CciI	TCATGA	1 cut(s)	642
Cfr13I	GGNCC	4 cut(s)	254, 341, 374, 475
Csp6I	GTAC	1 cut(s)	400
CspCI	CAANNNNNGTGG	2 cut(s)	591, 626
CviAII	CATG	6 cut(s)	118, 140, 196, 439, 637, 643
CviQI	GTAC	1 cut(s)	400
DdeI	CTNAG	5 cut(s)	60, 407, 417, 651, 690
DpnI	GATC	6 cut(s)	75, 132, 307, 570, 628, 633
DpnII	GATC	6 cut(s)	73, 130, 305, 568, 626, 631
EaeI	YGGCCR	1 cut(s)	180
Eam1104I	CTCTTC	1 cut(s)	465
EarI	CTCTTC	1 cut(s)	465
EciI	GGCGGA	1 cut(s)	561
Eco130I	CCWWGG	2 cut(s)	195, 337
Eco31I	GGTCTC	1 cut(s)	442
Eco32I	GATATC	1 cut(s)	219
Eco47I	GGWCC	1 cut(s)	475
EcoO109I	RGGNCCY	1 cut(s)	475
EcoRII	CCWGG	1 cut(s)	250
EcoRV	GATATC	1 cut(s)	219
EcoT14I	CCWWGG	2 cut(s)	195, 337
ErhI	CCWWGG	2 cut(s)	195, 337
FaeI	CATG	6 cut(s)	121, 143, 199, 442, 640, 646
FatI	CATG	6 cut(s)	117, 139, 195, 438, 636, 642
FauNDI	CATATG	1 cut(s)	331
FbaI	TGATCA	1 cut(s)	631
Fnu4HI	GCNGC	2 cut(s)	42, 123
FokI	GGATG	2 cut(s)	137, 595
Fsp4HI	GCNGC	2 cut(s)	42, 123
FspBI	CTAG	5 cut(s)	32, 38, 209, 224, 431
GluI	GCNGC	2 cut(s)	42, 123
HaeIII	GGCC	5 cut(s)	182, 255, 342, 375, 601
HapII	CCGG	1 cut(s)	543
Hin1II	CATG	6 cut(s)	121, 143, 199, 442, 640, 646
HincII	GTYRAC	2 cut(s)	55, 558
HindII	GTYRAC	2 cut(s)	55, 558
HinfI	GANTC	1 cut(s)	287
HpaII	CCGG	1 cut(s)	543
Hpy166II	GTNNAC	3 cut(s)	55, 400, 558
Hpy188I	TCNGA	4 cut(s)	91, 296, 631, 691
Hpy188III	TCNNGA	4 cut(s)	128, 209, 284, 643
Hpy8I	GTNNAC	3 cut(s)	55, 400, 558
HpyAV	CCTTC	1 cut(s)	559
HpyCH4III	ACNGT	3 cut(s)	167, 579, 608
HpyCH4IV	ACGT	1 cut(s)	396
HpyCH4V	TGCA	2 cut(s)	79, 673
HpyF10VI	GCNNNNNNNGC	2 cut(s)	661, 670
HpyF3I	CTNAG	5 cut(s)	60, 407, 417, 651, 690
HpySE526I	ACGT	1 cut(s)	396
Hsp92II	CATG	6 cut(s)	121, 143, 199, 442, 640, 646
Ksp22I	TGATCA	1 cut(s)	631
Kzo9I	GATC	6 cut(s)	73, 130, 305, 568, 626, 631
LpnPI	CCDG	8 cut(s)	33, 50, 237, 264, 491, 556, 583, 609
Lsp1109I	GCAGC	2 cut(s)	28, 134
MaeI	CTAG	5 cut(s)	32, 38, 209, 224, 431
MaeII	ACGT	1 cut(s)	396
MaeIII	GTNAC	3 cut(s)	14, 22, 161
MalI	GATC	6 cut(s)	75, 132, 307, 570, 628, 633
MboI	GATC	6 cut(s)	73, 130, 305, 568, 626, 631
MboII	GAAGA	2 cut(s)	309, 482
MflI	RGATCY	4 cut(s)	73, 305, 568, 626
MlsI	TGGCCA	1 cut(s)	182
MluCI	AATT	3 cut(s)	84, 112, 684
MluNI	TGGCCA	1 cut(s)	182
MlyI	GAGTC	1 cut(s)	296
MmeI	TCCRAC	1 cut(s)	598
MnlI	CCTC	8 cut(s)	69, 144, 272, 363, 412, 462, 466, 585
Mox20I	TGGCCA	1 cut(s)	182
MroXI	GAANNNNTTC	1 cut(s)	204
MscI	TGGCCA	1 cut(s)	182
MseI	TTAA	4 cut(s)	245, 279, 443, 588
MslI	CAYNNNNRTG	2 cut(s)	443, 641
Msp20I	TGGCCA	1 cut(s)	182
MspI	CCGG	1 cut(s)	543
MspR9I	CCNGG	1 cut(s)	252
MvaI	CCWGG	1 cut(s)	252
MwoI	GCNNNNNNNGC	2 cut(s)	661, 670
NcoI	CCATGG	1 cut(s)	195
NdeI	CATATG	1 cut(s)	331
NdeII	GATC	6 cut(s)	73, 130, 305, 568, 626, 631
NlaIII	CATG	6 cut(s)	121, 143, 199, 442, 640, 646
NlaIV	GGNNCC	1 cut(s)	436
NmuCI	GTSAC	3 cut(s)	14, 22, 161
PagI	TCATGA	1 cut(s)	642
PdmI	GAANNNNTTC	1 cut(s)	204
PkrI	GCNGC	2 cut(s)	43, 124
PleI	GAGTC	1 cut(s)	295
PpsI	GAGTC	1 cut(s)	295
PpuMI	RGGWCCY	1 cut(s)	475
Psp5II	RGGWCCY	1 cut(s)	475
Psp6I	CCWGG	1 cut(s)	250
PspGI	CCWGG	1 cut(s)	250
PspN4I	GGNNCC	1 cut(s)	436
PspPI	GGNCC	4 cut(s)	254, 341, 374, 475
PspPPI	RGGWCCY	1 cut(s)	475
PstNI	CAGNNNCTG	1 cut(s)	629
PsuI	RGATCY	4 cut(s)	73, 305, 568, 626
RsaI	GTAC	1 cut(s)	401
RsaNI	GTAC	1 cut(s)	400
RseI	CAYNNNNRTG	2 cut(s)	443, 641
SaqAI	TTAA	4 cut(s)	245, 279, 443, 588
SatI	GCNGC	2 cut(s)	42, 123
Sau3AI	GATC	6 cut(s)	73, 130, 305, 568, 626, 631
Sau96I	GGNCC	4 cut(s)	254, 341, 374, 475
SchI	GAGTC	1 cut(s)	296
ScrFI	CCNGG	1 cut(s)	252
SetI	ASST	9 cut(s)	39, 43, 127, 150, 399, 454, 480, 498, 666
SinI	GGWCC	1 cut(s)	475
SmiMI	CAYNNNNRTG	2 cut(s)	443, 641
SmlI	CTYRAG	1 cut(s)	491
SmoI	CTYRAG	1 cut(s)	491
Sse9I	AATT	3 cut(s)	84, 112, 684
SsiI	CCGC	1 cut(s)	546
SspI	AATATT	1 cut(s)	698
SspMI	CTAG	5 cut(s)	32, 38, 209, 224, 431
StyD4I	CCNGG	1 cut(s)	250
StyI	CCWWGG	2 cut(s)	195, 337
TaaI	ACNGT	3 cut(s)	167, 579, 608
TaiI	ACGT	1 cut(s)	399
TaqII	GACCGA	1 cut(s)	508
TasI	AATT	3 cut(s)	84, 112, 684
Tru1I	TTAA	4 cut(s)	245, 279, 443, 588
Tru9I	TTAA	4 cut(s)	245, 279, 443, 588
TscAI	CASTG	1 cut(s)	244
TseFI	GTSAC	3 cut(s)	14, 22, 161
TseI	GCWGC	2 cut(s)	41, 122
Tsp45I	GTSAC	3 cut(s)	14, 22, 161
TspDTI	ATGAA	3 cut(s)	17, 106, 223
TspGWI	ACGGA	1 cut(s)	575
TspRI	CASTG	1 cut(s)	244
VpaK11BI	GGWCC	1 cut(s)	475
XapI	RAATTY	2 cut(s)	112, 684
XbaI	TCTAGA	1 cut(s)	208
XcmI	CCANNNNNNNNNTGG	1 cut(s)	663
XmnI	GAANNNNTTC	1 cut(s)	204
XspI	CTAG	5 cut(s)	32, 38, 209, 224, 431

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.