Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0012663

Physical Location & Seq

Genomic Coordinates Reverse (-)

14679977 .. 14680491

Gene Structure 515 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ23260

Sequence Viewer

CDS Protein Promoter (2k)

Length: 429 bp

ATGCAACTACAGTCATTTCGGCGCCAAGATTCTCAATTGGACAGCCGATTTACATATGACCAAGGGCCAAACAACCCTCCAACAACTTTCATCTTCGGTCCCGTGTATTTGGCAACTAAGGTCTACCAACTTAGCCCTAAGGAGGATATAGAACTGGCCAGTATGTTAATGAGACCACTACGTTTGTTTAGTGAAGAAGACATGTCTAAGGAACTAAAGCTGTCCAAGGAGAAATACGGGTCGGTCAACCGGGTTTGCATAATCTCAGATGAAGATTTGGTCGAAAGGAAAGATTTTCAACTGTGGGTGATTGAGAGAAATCGCCCAAATCGTGTGGTGGAAATGAGAGGATCAGATCACATGGTCATGATGTCAAAGCCATTAGAGCTTTGGGGGCTTCTTCAAAACCTTGCTACAAATTATTCGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Abhydrolase_1 Abhydrolase_6

Protein Analysis

142

Amino Acids

16.7

Weight (kDa)

5.89

Isoelectric Point (pI)

57.0

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012663)

Species	Orthologous Gene IDs
malus_domestica	MD05G1074300.v1.1
prunus_persica	Prupe.8G114700_v2.0.a1 Prupe.8G115000_v2.0.a1 Prupe.8G115300_v2.0.a1
pyrus_communis	pycom05g06700
rosa_chinensis	RchiOBHm_Chr4g0407461 RchiOBHm_Chr6g0259411 RchiOBHm_Chr6g0259431
rosa_laevigata	RLG00000014534
rosa_multiflora	Rmu_sc0006836.1_g000015 Rmu_ssc0000050.1_g000045
rosa_roxburghii	Rroxscaffold_7G00206700
rosa_rugosa	Rorug05G0588800 Rorug06G0097000
rosa_samantha	Rh6AG104500 Rh6BG097700 Rh6CG093600 Rh6DG087500
rosa_wichuraiana	Rw6G009030

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	21
AccI	GTMKAC	1 cut(s)	123
AclWI	GGATC	1 cut(s)	358
AcoI	YGGCCR	1 cut(s)	156
AcyI	GRCGYC	1 cut(s)	22
AfiI	CCNNNNNNNGG	1 cut(s)	142
AflIII	ACRYGT	1 cut(s)	201
AgsI	TTSAA	2 cut(s)	299, 404
AluBI	AGCT	2 cut(s)	220, 388
AluI	AGCT	2 cut(s)	220, 388
Alw26I	GTCTC	1 cut(s)	166
AlwI	GGATC	1 cut(s)	358
AoxI	GGCC	2 cut(s)	65, 156
AspLEI	GCGC	1 cut(s)	24
AspS9I	GGNCC	2 cut(s)	65, 98
AsuC2I	CCSGG	1 cut(s)	251
AsuHPI	GGTGA	1 cut(s)	319
AvaII	GGWCC	1 cut(s)	98
AxyI	CCTNAGG	1 cut(s)	138
BalI	TGGCCA	1 cut(s)	158
BanI	GGYRCC	1 cut(s)	21
BbsI	GAAGAC	1 cut(s)	204
BcnI	CCSGG	1 cut(s)	251
BcoDI	GTCTC	1 cut(s)	166
BfmI	CTRYAG	1 cut(s)	8
BfoI	RGCGCY	1 cut(s)	25
Bme1390I	CCNGG	1 cut(s)	251
Bme18I	GGWCC	1 cut(s)	98
BmgT120I	GGNCC	2 cut(s)	65, 98
BmiI	GGNNCC	2 cut(s)	23, 100
BmrFI	CCNGG	1 cut(s)	251
BpiI	GAAGAC	1 cut(s)	204
BpuMI	CCSGG	1 cut(s)	251
BsaHI	GRCGYC	1 cut(s)	22
BsaI	GGTCTC	1 cut(s)	166
BsaJI	CCNNGG	2 cut(s)	61, 225
Bsc4I	CCNNNNNNNGG	1 cut(s)	142
Bse1I	ACTGG	2 cut(s)	159, 159
Bse21I	CCTNAGG	1 cut(s)	138
BseDI	CCNNGG	2 cut(s)	61, 225
BseLI	CCNNNNNNNGG	1 cut(s)	142
BseMII	CTCAG	1 cut(s)	279
BseNI	ACTGG	2 cut(s)	159, 159
BshFI	GGCC	2 cut(s)	67, 158
BshNI	GGYRCC	1 cut(s)	21
BsiSI	CCGG	1 cut(s)	250
BslFI	GGGAC	1 cut(s)	84
BslI	CCNNNNNNNGG	1 cut(s)	142
BsmAI	GTCTC	1 cut(s)	166
BsmFI	GGGAC	1 cut(s)	84
BsnI	GGCC	2 cut(s)	67, 158
Bso31I	GGTCTC	1 cut(s)	166
Bsp143I	GATC	2 cut(s)	350, 355
BspANI	GGCC	2 cut(s)	67, 158
BspCNI	CTCAG	1 cut(s)	278
BspHI	TCATGA	1 cut(s)	366
BspLI	GGNNCC	2 cut(s)	23, 100
BspPI	GGATC	1 cut(s)	358
BspT107I	GGYRCC	1 cut(s)	21
BspTNI	GGTCTC	1 cut(s)	166
BsrI	ACTGG	2 cut(s)	159, 159
BssECI	CCNNGG	2 cut(s)	61, 225
BssMI	GATC	2 cut(s)	350, 355
BssNI	GRCGYC	1 cut(s)	22
BssT1I	CCWWGG	2 cut(s)	61, 225
Bst4CI	ACNGT	2 cut(s)	12, 303
BstACI	GRCGYC	1 cut(s)	22
BstDEI	CTNAG	5 cut(s)	117, 131, 138, 207, 265
BstH2I	RGCGCY	1 cut(s)	25
BstHHI	GCGC	1 cut(s)	24
BstKTI	GATC	2 cut(s)	353, 358
BstMAI	GTCTC	1 cut(s)	166
BstMBI	GATC	2 cut(s)	350, 355
BstMWI	GCNNNNNNNGC	2 cut(s)	385, 394
BstNSI	RCATGY	1 cut(s)	205
BstSCI	CCNGG	1 cut(s)	249
BstSFI	CTRYAG	1 cut(s)	8
BstV2I	GAAGAC	1 cut(s)	204
Bsu36I	CCTNAGG	1 cut(s)	138
BsuRI	GGCC	2 cut(s)	67, 158
CciI	TCATGA	1 cut(s)	366
CfoI	GCGC	1 cut(s)	24
Cfr13I	GGNCC	2 cut(s)	65, 98
CspCI	CAANNNNNGTGG	4 cut(s)	165, 200, 315, 350
CviAII	CATG	3 cut(s)	202, 361, 367
CviJI	RGCY	8 cut(s)	45, 67, 135, 158, 220, 379, 388, 397
CviKI_1	RGCY	8 cut(s)	45, 67, 135, 158, 220, 379, 388, 397
DdeI	CTNAG	5 cut(s)	117, 131, 138, 207, 265
DinI	GGCGCC	1 cut(s)	23
DpnI	GATC	2 cut(s)	352, 357
DpnII	GATC	2 cut(s)	350, 355
EaeI	YGGCCR	1 cut(s)	156
Eco130I	CCWWGG	2 cut(s)	61, 225
Eco31I	GGTCTC	1 cut(s)	166
Eco47I	GGWCC	1 cut(s)	98
Eco81I	CCTNAGG	1 cut(s)	138
EcoT14I	CCWWGG	2 cut(s)	61, 225
EgeI	GGCGCC	1 cut(s)	23
EheI	GGCGCC	1 cut(s)	23
ErhI	CCWWGG	2 cut(s)	61, 225
FaeI	CATG	3 cut(s)	205, 364, 370
FaiI	YATR	8 cut(s)	55, 57, 149, 164, 203, 260, 362, 368
FaqI	GGGAC	1 cut(s)	84
FatI	CATG	3 cut(s)	201, 360, 366
FauNDI	CATATG	1 cut(s)	55
FblI	GTMKAC	1 cut(s)	123
GlaI	GCGC	1 cut(s)	23
HaeII	RGCGCY	1 cut(s)	25
HaeIII	GGCC	2 cut(s)	67, 158
HapII	CCGG	1 cut(s)	250
HhaI	GCGC	1 cut(s)	24
Hin1I	GRCGYC	1 cut(s)	22
Hin1II	CATG	3 cut(s)	205, 364, 370
Hin6I	GCGC	1 cut(s)	22
HinP1I	GCGC	1 cut(s)	22
HincII	GTYRAC	1 cut(s)	247
HindII	GTYRAC	1 cut(s)	247
HinfI	GANTC	1 cut(s)	29
HpaII	CCGG	1 cut(s)	250
HphI	GGTGA	1 cut(s)	319
Hpy166II	GTNNAC	2 cut(s)	124, 247
Hpy188I	TCNGA	2 cut(s)	268, 355
Hpy188III	TCNNGA	1 cut(s)	367
Hpy8I	GTNNAC	2 cut(s)	124, 247
HpyCH4III	ACNGT	2 cut(s)	12, 303
HpyCH4IV	ACGT	1 cut(s)	181
HpyCH4V	TGCA	2 cut(s)	4, 258
HpyF10VI	GCNNNNNNNGC	2 cut(s)	385, 394
HpyF3I	CTNAG	5 cut(s)	117, 131, 138, 207, 265
HpySE526I	ACGT	1 cut(s)	181
Hsp92I	GRCGYC	1 cut(s)	22
Hsp92II	CATG	3 cut(s)	205, 364, 370
HspAI	GCGC	1 cut(s)	22
KasI	GGCGCC	1 cut(s)	21
Kzo9I	GATC	2 cut(s)	350, 355
LpnPI	CCDG	3 cut(s)	140, 172, 263
MaeII	ACGT	1 cut(s)	181
MalI	GATC	2 cut(s)	352, 357
MboI	GATC	2 cut(s)	350, 355
MboII	GAAGA	5 cut(s)	85, 206, 209, 284, 392
MfeI	CAATTG	1 cut(s)	35
MlsI	TGGCCA	1 cut(s)	158
MluCI	AATT	2 cut(s)	35, 418
MluNI	TGGCCA	1 cut(s)	158
Mly113I	GGCGCC	1 cut(s)	22
MmeI	TCCRAC	1 cut(s)	104
MnlI	CCTC	3 cut(s)	87, 136, 341
Mox20I	TGGCCA	1 cut(s)	158
MscI	TGGCCA	1 cut(s)	158
MseI	TTAA	1 cut(s)	167
MslI	CAYNNNNRTG	1 cut(s)	365
Msp20I	TGGCCA	1 cut(s)	158
MspI	CCGG	1 cut(s)	250
MspR9I	CCNGG	1 cut(s)	251
MunI	CAATTG	1 cut(s)	35
MwoI	GCNNNNNNNGC	2 cut(s)	385, 394
NarI	GGCGCC	1 cut(s)	22
NciI	CCSGG	1 cut(s)	251
NdeI	CATATG	1 cut(s)	55
NdeII	GATC	2 cut(s)	350, 355
NlaIII	CATG	3 cut(s)	205, 364, 370
NlaIV	GGNNCC	2 cut(s)	23, 100
NspI	RCATGY	1 cut(s)	205
PagI	TCATGA	1 cut(s)	366
PciI	ACATGT	1 cut(s)	201
PcsI	WCGNNNNNNNCGW	1 cut(s)	328
PfeI	GAWTC	1 cut(s)	29
PluTI	GGCGCC	1 cut(s)	25
PscI	ACATGT	1 cut(s)	201
PspN4I	GGNNCC	2 cut(s)	23, 100
PspPI	GGNCC	2 cut(s)	65, 98
RseI	CAYNNNNRTG	1 cut(s)	365
SaqAI	TTAA	1 cut(s)	167
Sau3AI	GATC	2 cut(s)	350, 355
Sau96I	GGNCC	2 cut(s)	65, 98
ScrFI	CCNGG	1 cut(s)	251
SetI	ASST	5 cut(s)	123, 184, 222, 390, 411
SfcI	CTRYAG	1 cut(s)	8
SfoI	GGCGCC	1 cut(s)	23
SinI	GGWCC	1 cut(s)	98
SmiMI	CAYNNNNRTG	1 cut(s)	365
Sse9I	AATT	2 cut(s)	35, 418
SspDI	GGCGCC	1 cut(s)	21
StyD4I	CCNGG	1 cut(s)	249
StyI	CCWWGG	2 cut(s)	61, 225
TaaI	ACNGT	2 cut(s)	12, 303
TaiI	ACGT	1 cut(s)	184
TaqI	TCGA	1 cut(s)	282
TaqII	GACCGA	2 cut(s)	86, 232
TasI	AATT	2 cut(s)	35, 418
TfiI	GAWTC	1 cut(s)	29
Tru1I	TTAA	1 cut(s)	167
Tru9I	TTAA	1 cut(s)	167
TspDTI	ATGAA	2 cut(s)	79, 285
VpaK11BI	GGWCC	1 cut(s)	98
XceI	RCATGY	1 cut(s)	205
XcmI	CCANNNNNNNNNTGG	1 cut(s)	387
XmiI	GTMKAC	1 cut(s)	123

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.