pycom01g06570

dipeptidyl-peptidase activity

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Forward (+)
6986853 .. 6987215
363 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g06570.1

Sequence Viewer

Length: 363 bp
ATGGAAAATGTTGCCTATTTGTCCGATCTCCTAAAGTGGACTCAGCAACATTTTACCACTTTTGAACTAGCGCTCCGAGCCGAGGACAACCTGAAGACGAGGAAGACCGCGTATGAAGCCAACCGGCCAGAGGTCGAGGCAATAAAAACAAAGAAGGCACAGATGATCGGTTTTGATTGTCAAATTTCTGAGCTTCAGCATCAAATCACCGAGCTTCAACAACAAAGGTCGGTTGTTGCTTCAGAGCTCGAGAGGGATTTTGAGGCGAACAAGGCTCGATTAACGACTTTCGCAGTCAGCATAAAGCAGATCCAACAGCTTCAACTCAATAAAAAGACGAGGCAGGCCGATCGATCATACTAA

Protein Analysis

121

Amino Acids

14.03

Weight (kDa)

8.73

Isoelectric Point (pI)

44.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 110
AciI CCGC 1 cut(s) 108
AclWI GGATC 1 cut(s) 304
AcoI YGGCCR 1 cut(s) 125
AcsI RAATTY 1 cut(s) 183
AcuI CTGAAG 3 cut(s) 113, 179, 225
AfeI AGCGCT 1 cut(s) 72
AfiI CCNNNNNNNGG 2 cut(s) 82, 130
AgsI TTSAA 3 cut(s) 65, 218, 323
AloI GAACNNNNNNTCC 2 cut(s) 57, 89
AluBI AGCT 4 cut(s) 193, 214, 247, 319
AluI AGCT 4 cut(s) 193, 214, 247, 319
Alw21I GWGCWC 1 cut(s) 249
AlwI GGATC 1 cut(s) 304
Ama87I CYCGRG 1 cut(s) 248
Aor51HI AGCGCT 1 cut(s) 72
AoxI GGCC 2 cut(s) 125, 345
ApoI RAATTY 1 cut(s) 183
AspLEI GCGC 1 cut(s) 73
AsuHPI GGTGA 1 cut(s) 199
AvaI CYCGRG 1 cut(s) 248
BanII GRGCYC 1 cut(s) 249
BbsI GAAGAC 2 cut(s) 101, 110
Bbv12I GWGCWC 1 cut(s) 249
BcgI CGANNNNNNTGC 1 cut(s) 332
BfaI CTAG 1 cut(s) 68
BfoI RGCGCY 1 cut(s) 74
BmeT110I CYCGRG 1 cut(s) 248
BmsI GCATC 1 cut(s) 208
BpiI GAAGAC 2 cut(s) 101, 110
Bsa29I ATCGAT 1 cut(s) 352
BsaJI CCNNGG 1 cut(s) 81
BsaXI ACNNNNNCTCC 2 cut(s) 57, 87
Bsc4I CCNNNNNNNGG 2 cut(s) 82, 130
Bse118I RCCGGY 1 cut(s) 123
BseCI ATCGAT 1 cut(s) 352
BseDI CCNNGG 1 cut(s) 81
BseLI CCNNNNNNNGG 2 cut(s) 82, 130
BseMII CTCAG 2 cut(s) 56, 180
Bsh1236I CGCG 1 cut(s) 110
Bsh1285I CGRYCG 1 cut(s) 352
BshFI GGCC 2 cut(s) 127, 347
BshVI ATCGAT 1 cut(s) 352
BsiEI CGRYCG 1 cut(s) 352
BsiHKAI GWGCWC 1 cut(s) 249
BsiHKCI CYCGRG 1 cut(s) 248
BsiSI CCGG 1 cut(s) 124
BslI CCNNNNNNNGG 2 cut(s) 82, 130
BsnI GGCC 2 cut(s) 127, 347
BsoBI CYCGRG 1 cut(s) 248
Bsp1286I GDGCHC 1 cut(s) 249
Bsp143I GATC 5 cut(s) 25, 165, 309, 349, 353
BspACI CCGC 1 cut(s) 108
BspANI GGCC 2 cut(s) 127, 347
BspCNI CTCAG 2 cut(s) 55, 181
BspDI ATCGAT 1 cut(s) 352
BspFNI CGCG 1 cut(s) 110
BspPI GGATC 1 cut(s) 304
BsrFI RCCGGY 1 cut(s) 123
BssAI RCCGGY 1 cut(s) 123
BssECI CCNNGG 1 cut(s) 81
BssMI GATC 5 cut(s) 25, 165, 309, 349, 353
BstC8I GCNNGC 1 cut(s) 345
BstDEI CTNAG 2 cut(s) 42, 189
BstFNI CGCG 1 cut(s) 110
BstH2I RGCGCY 1 cut(s) 74
BstHHI GCGC 1 cut(s) 73
BstKTI GATC 5 cut(s) 28, 168, 312, 352, 356
BstMBI GATC 5 cut(s) 25, 165, 309, 349, 353
BstMCI CGRYCG 1 cut(s) 352
BstMWI GCNNNNNNNGC 3 cut(s) 77, 116, 272
BstUI CGCG 1 cut(s) 110
BstV2I GAAGAC 2 cut(s) 101, 110
BstX2I RGATCY 1 cut(s) 309
BstYI RGATCY 1 cut(s) 309
Bsu15I ATCGAT 1 cut(s) 352
BsuRI GGCC 2 cut(s) 127, 347
BsuTUI ATCGAT 1 cut(s) 352
Cac8I GCNNGC 1 cut(s) 345
CfoI GCGC 1 cut(s) 73
Cfr10I RCCGGY 1 cut(s) 123
ClaI ATCGAT 1 cut(s) 352
CviJI RGCY 9 cut(s) 80, 119, 127, 193, 214, 247, 275, 319, 347
CviKI_1 RGCY 9 cut(s) 80, 119, 127, 193, 214, 247, 275, 319, 347
DdeI CTNAG 2 cut(s) 42, 189
DpnI GATC 5 cut(s) 27, 167, 311, 351, 355
DpnII GATC 5 cut(s) 25, 165, 309, 349, 353
EaeI YGGCCR 1 cut(s) 125
Ecl136II GAGCTC 1 cut(s) 247
Eco24I GRGCYC 1 cut(s) 249
Eco47III AGCGCT 1 cut(s) 72
Eco53kI GAGCTC 1 cut(s) 247
Eco57I CTGAAG 3 cut(s) 113, 179, 225
Eco88I CYCGRG 1 cut(s) 248
EcoICRI GAGCTC 1 cut(s) 247
EcoT38I GRGCYC 1 cut(s) 249
FaiI YATR 3 cut(s) 114, 302, 358
FriOI GRGCYC 1 cut(s) 249
FspBI CTAG 1 cut(s) 68
GlaI GCGC 1 cut(s) 72
HaeII RGCGCY 1 cut(s) 74
HaeIII GGCC 2 cut(s) 127, 347
HapII CCGG 1 cut(s) 124
HhaI GCGC 1 cut(s) 73
Hin6I GCGC 1 cut(s) 71
HinP1I GCGC 1 cut(s) 71
HinfI GANTC 1 cut(s) 40
HpaII CCGG 1 cut(s) 124
HphI GGTGA 1 cut(s) 199
Hpy166II GTNNAC 1 cut(s) 39
Hpy188I TCNGA 4 cut(s) 25, 77, 190, 244
Hpy188III TCNNGA 1 cut(s) 250
Hpy8I GTNNAC 1 cut(s) 39
HpyAV CCTTC 1 cut(s) 148
HpyF10VI GCNNNNNNNGC 3 cut(s) 77, 116, 272
HpyF3I CTNAG 2 cut(s) 42, 189
HspAI GCGC 1 cut(s) 71
Kzo9I GATC 5 cut(s) 25, 165, 309, 349, 353
LmnI GCTCC 1 cut(s) 78
LpnPI CCDG 4 cut(s) 104, 137, 141, 329
LweI GCATC 1 cut(s) 208
MaeI CTAG 1 cut(s) 68
MalI GATC 5 cut(s) 27, 167, 311, 351, 355
MboI GATC 5 cut(s) 25, 165, 309, 349, 353
MboII GAAGA 2 cut(s) 106, 115
MflI RGATCY 1 cut(s) 309
MhlI GDGCHC 1 cut(s) 249
MluCI AATT 1 cut(s) 183
MlyI GAGTC 1 cut(s) 34
MmeI TCCRAC 1 cut(s) 337
MnlI CCTC 7 cut(s) 76, 93, 124, 130, 246, 256, 333
MseI TTAA 1 cut(s) 281
MspI CCGG 1 cut(s) 124
MvnI CGCG 1 cut(s) 110
MwoI GCNNNNNNNGC 3 cut(s) 77, 116, 272
NdeII GATC 5 cut(s) 25, 165, 309, 349, 353
NmeAIII GCCGAG 1 cut(s) 106
PaeR7I CTCGAG 1 cut(s) 248
Ple19I CGATCG 1 cut(s) 352
PleI GAGTC 1 cut(s) 34
PpsI GAGTC 1 cut(s) 34
Psp124BI GAGCTC 1 cut(s) 249
PsuI RGATCY 1 cut(s) 309
PvuI CGATCG 1 cut(s) 352
SacI GAGCTC 1 cut(s) 249
SaqAI TTAA 1 cut(s) 281
Sau3AI GATC 5 cut(s) 25, 165, 309, 349, 353
SchI GAGTC 1 cut(s) 34
SduI GDGCHC 1 cut(s) 249
SetI ASST 7 cut(s) 93, 135, 195, 216, 230, 249, 321
SfaNI GCATC 1 cut(s) 208
Sfr274I CTCGAG 1 cut(s) 248
SlaI CTCGAG 1 cut(s) 248
SmlI CTYRAG 1 cut(s) 248
SmoI CTYRAG 1 cut(s) 248
Sse9I AATT 1 cut(s) 183
SsiI CCGC 1 cut(s) 108
SspMI CTAG 1 cut(s) 68
SstI GAGCTC 1 cut(s) 249
TaqI TCGA 4 cut(s) 135, 249, 277, 352
TasI AATT 1 cut(s) 183
Tru1I TTAA 1 cut(s) 281
Tru9I TTAA 1 cut(s) 281
TspDTI ATGAA 1 cut(s) 129
XapI RAATTY 1 cut(s) 183
XhoI CTCGAG 1 cut(s) 248
XspI CTAG 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.