RchiOBHm_Chr6g0263221

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
17987162 .. 17989229
2068 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23608

Sequence Viewer

Length: 270 bp
ATGAAAGATAATATTTCATGTTTAGCCGCTCCATCAATTAAGAGATCGGCCATTGGCATAGGATACTCATCTTTTGGAGTTGCTAAATTTAAGTTTCTGAAGTCAACGCATACTCTCATCTTGCCATTTTTCTTTCTTACAGGTACAGCGTTGGAAACCCATTCCACATATCTAGCAGGTCTAATAAATTTAGCATGTAATAATCGTTCAATTTCCTCTTTCATTTCAATTTGCACCTCGGCGGAACATCGCCGAGGAGCTTGTTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

9.6

Weight (kDa)

9.56

Isoelectric Point (pI)

60.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 268
Acc36I ACCTGC 1 cut(s) 167
AccBSI CCGCTC 1 cut(s) 29
AciI CCGC 2 cut(s) 27, 242
AcoI YGGCCR 1 cut(s) 48
AcsI RAATTY 2 cut(s) 86, 187
AcuI CTGAAG 1 cut(s) 119
AfaI GTAC 1 cut(s) 145
AgsI TTSAA 2 cut(s) 210, 228
AluBI AGCT 1 cut(s) 260
AluI AGCT 1 cut(s) 260
AoxI GGCC 1 cut(s) 48
ApoI RAATTY 2 cut(s) 86, 187
BccI CCATC 1 cut(s) 40
BciVI GTATCC 1 cut(s) 56
BfaI CTAG 1 cut(s) 173
BfuAI ACCTGC 1 cut(s) 167
BfuI GTATCC 1 cut(s) 56
BisI GCNGC 1 cut(s) 27
BlsI GCNGC 1 cut(s) 28
BsaBI GATNNNNATC 1 cut(s) 67
BsaJI CCNNGG 2 cut(s) 237, 253
Bse8I GATNNNNATC 1 cut(s) 67
BseDI CCNNGG 2 cut(s) 237, 253
BseJI GATNNNNATC 1 cut(s) 67
BseRI GAGGAG 1 cut(s) 270
BshFI GGCC 1 cut(s) 50
BsnI GGCC 1 cut(s) 50
Bsp143I GATC 1 cut(s) 44
BspACI CCGC 2 cut(s) 27, 242
BspANI GGCC 1 cut(s) 50
BspMI ACCTGC 1 cut(s) 167
BsrBI CCGCTC 1 cut(s) 29
BssECI CCNNGG 2 cut(s) 237, 253
BssMI GATC 1 cut(s) 44
BstKTI GATC 1 cut(s) 47
BstMBI GATC 1 cut(s) 44
BstNSI RCATGY 1 cut(s) 198
BsuI GTATCC 1 cut(s) 56
BsuRI GGCC 1 cut(s) 50
BtgZI GCGATG 1 cut(s) 233
BveI ACCTGC 1 cut(s) 167
Csp6I GTAC 1 cut(s) 144
CviAII CATG 2 cut(s) 18, 195
CviJI RGCY 3 cut(s) 26, 50, 260
CviKI_1 RGCY 3 cut(s) 26, 50, 260
CviQI GTAC 1 cut(s) 144
DpnI GATC 1 cut(s) 46
DpnII GATC 1 cut(s) 44
EaeI YGGCCR 1 cut(s) 48
EciI GGCGGA 1 cut(s) 257
Eco57I CTGAAG 1 cut(s) 119
FaeI CATG 2 cut(s) 21, 198
FaiI YATR 6 cut(s) 19, 59, 111, 169, 196, 268
FatI CATG 2 cut(s) 17, 194
Fnu4HI GCNGC 1 cut(s) 27
Fsp4HI GCNGC 1 cut(s) 27
FspBI CTAG 1 cut(s) 173
GluI GCNGC 1 cut(s) 27
HaeIII GGCC 1 cut(s) 50
Hin1II CATG 2 cut(s) 21, 198
HincII GTYRAC 1 cut(s) 105
HindII GTYRAC 1 cut(s) 105
Hpy166II GTNNAC 1 cut(s) 105
Hpy188I TCNGA 1 cut(s) 99
Hpy8I GTNNAC 1 cut(s) 105
HpyCH4V TGCA 1 cut(s) 234
Hsp92II CATG 2 cut(s) 21, 198
Kzo9I GATC 1 cut(s) 44
LmnI GCTCC 2 cut(s) 34, 257
LpnPI CCDG 2 cut(s) 126, 162
MaeI CTAG 1 cut(s) 173
MalI GATC 1 cut(s) 46
MbiI CCGCTC 1 cut(s) 29
MboI GATC 1 cut(s) 44
MluCI AATT 5 cut(s) 36, 86, 187, 210, 228
MmeI TCCRAC 1 cut(s) 132
MnlI CCTC 3 cut(s) 226, 247, 248
MseI TTAA 2 cut(s) 39, 90
NdeII GATC 1 cut(s) 44
NlaIII CATG 2 cut(s) 21, 198
NmeAIII GCCGAG 1 cut(s) 218
NspI RCATGY 1 cut(s) 198
PkrI GCNGC 1 cut(s) 28
PsiI TTATAA 1 cut(s) 268
PsrI GAACNNNNNNTAC 2 cut(s) 190, 222
RsaI GTAC 1 cut(s) 145
RsaNI GTAC 1 cut(s) 144
SaqAI TTAA 2 cut(s) 39, 90
SatI GCNGC 1 cut(s) 27
Sau3AI GATC 1 cut(s) 44
SetI ASST 4 cut(s) 145, 181, 239, 262
SgeI CNNG 8 cut(s) 30, 133, 153, 185, 189, 207, 250, 266
Sse9I AATT 5 cut(s) 36, 86, 187, 210, 228
SsiI CCGC 2 cut(s) 27, 242
SspI AATATT 1 cut(s) 13
SspMI CTAG 1 cut(s) 173
TasI AATT 5 cut(s) 36, 86, 187, 210, 228
TauI GCSGC 1 cut(s) 29
Tru1I TTAA 2 cut(s) 39, 90
Tru9I TTAA 2 cut(s) 39, 90
TspDTI ATGAA 3 cut(s) 6, 17, 211
XapI RAATTY 2 cut(s) 86, 187
XceI RCATGY 1 cut(s) 198
XspI CTAG 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.