pycom01g07090
MADS Family

MADS-box transcription factor

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Forward (+)
7708990 .. 7712146
3157 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g07090.2

Sequence Viewer

Length: 210 bp
ATGGGGAGGGGGAAGATTGTGATTCGGAAGATCGATAATTCGACGAGCAGGCAAGTGACTTTCTCAAAGCGTAGGAAGGGTTTAATTAAGAAGGCAAAAGAGCTGGCGATTTTGTGCGATGCAGAAGTTGGACTTGTGATCTTCTCAAGCACCGAAAAGCTTTATGAATTTGCAAGCAACAGGGTTCATGAAGGCATGATGGTAGGATAG

Protein Analysis

70

Amino Acids

7.74

Weight (kDa)

10.1

Isoelectric Point (pI)

25.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0009755)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 167
AluBI AGCT 2 cut(s) 103, 160
AluI AGCT 2 cut(s) 103, 160
ApoI RAATTY 1 cut(s) 167
BccI CCATC 1 cut(s) 193
BmsI GCATC 1 cut(s) 109
BpuEI CTTGAG 1 cut(s) 130
Bsa29I ATCGAT 1 cut(s) 33
BseCI ATCGAT 1 cut(s) 33
BshVI ATCGAT 1 cut(s) 33
Bsp143I GATC 2 cut(s) 30, 138
BspDI ATCGAT 1 cut(s) 33
BspHI TCATGA 1 cut(s) 187
BssMI GATC 2 cut(s) 30, 138
BstC8I GCNNGC 3 cut(s) 50, 105, 175
BstKTI GATC 2 cut(s) 33, 141
BstMBI GATC 2 cut(s) 30, 138
Bsu15I ATCGAT 1 cut(s) 33
BsuTUI ATCGAT 1 cut(s) 33
BtgZI GCGATG 1 cut(s) 132
Cac8I GCNNGC 3 cut(s) 50, 105, 175
CciI TCATGA 1 cut(s) 187
ClaI ATCGAT 1 cut(s) 33
CviAII CATG 2 cut(s) 188, 196
CviJI RGCY 2 cut(s) 103, 160
CviKI_1 RGCY 2 cut(s) 103, 160
DpnI GATC 2 cut(s) 32, 140
DpnII GATC 2 cut(s) 30, 138
FaeI CATG 2 cut(s) 191, 199
FaiI YATR 3 cut(s) 165, 189, 197
FalI AAGNNNNNCTT 2 cut(s) 117, 149
FatI CATG 2 cut(s) 187, 195
Hin1II CATG 2 cut(s) 191, 199
HindIII AAGCTT 1 cut(s) 158
HinfI GANTC 1 cut(s) 22
Hpy188I TCNGA 1 cut(s) 27
Hpy188III TCNNGA 1 cut(s) 188
Hpy99I CGWCG 1 cut(s) 46
HpyAV CCTTC 3 cut(s) 70, 85, 185
HpyCH4V TGCA 2 cut(s) 122, 173
Hsp92II CATG 2 cut(s) 191, 199
Kzo9I GATC 2 cut(s) 30, 138
LpnPI CCDG 3 cut(s) 34, 89, 166
LweI GCATC 1 cut(s) 109
MaeIII GTNAC 1 cut(s) 55
MalI GATC 2 cut(s) 32, 140
MboI GATC 2 cut(s) 30, 138
MboII GAAGA 3 cut(s) 25, 40, 133
MluCI AATT 3 cut(s) 37, 84, 167
MmeI TCCRAC 1 cut(s) 109
MseI TTAA 2 cut(s) 83, 87
NdeII GATC 2 cut(s) 30, 138
NlaIII CATG 2 cut(s) 191, 199
NmuCI GTSAC 1 cut(s) 55
PacI TTAATTAA 1 cut(s) 87
PagI TCATGA 1 cut(s) 187
PfeI GAWTC 1 cut(s) 22
SaqAI TTAA 2 cut(s) 83, 87
Sau3AI GATC 2 cut(s) 30, 138
SetI ASST 2 cut(s) 105, 162
SfaNI GCATC 1 cut(s) 109
SgeI CNNG 9 cut(s) 57, 61, 65, 116, 146, 159, 186, 193, 200
SmlI CTYRAG 1 cut(s) 145
SmoI CTYRAG 1 cut(s) 145
Sse9I AATT 3 cut(s) 37, 84, 167
TaqI TCGA 2 cut(s) 33, 41
TasI AATT 3 cut(s) 37, 84, 167
TfiI GAWTC 1 cut(s) 22
Tru1I TTAA 2 cut(s) 83, 87
Tru9I TTAA 2 cut(s) 83, 87
TseFI GTSAC 1 cut(s) 55
Tsp45I GTSAC 1 cut(s) 55
TspDTI ATGAA 3 cut(s) 176, 180, 204
XapI RAATTY 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.