pycom01g23990

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
OG0016957
Physical Location & Seq
Reverse (-)
21084822 .. 21085070
249 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g23990.1

Sequence Viewer

Length: 249 bp
ATGAATGATAATGCCTCATGGCCAGTGGTTGCATCCACCATGATTTCAATGATTGGCAAGGGGAAGTCATCCTTTGGGCAAGCATCGTTGAGGTCCCGGAAGTCTACGCAAACACGTATTTGTCCTGATTTTTTAAGGACAATGACGATGTTGGAGATCCACTTGGGGTATTGCACTTCTCGAATAAAGCCTGCTTCGATTAGCTTGTCGATCTCGACCTCGATTTGTGGGATAAGCTCAGATCGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

8.92

Weight (kDa)

9.92

Isoelectric Point (pI)

33.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 104
AclWI GGATC 1 cut(s) 151
AcoI YGGCCR 1 cut(s) 20
AflIII ACRYGT 1 cut(s) 113
AgsI TTSAA 1 cut(s) 48
AluBI AGCT 2 cut(s) 204, 237
AluI AGCT 2 cut(s) 204, 237
AlwI GGATC 1 cut(s) 151
AoxI GGCC 1 cut(s) 20
AspS9I GGNCC 1 cut(s) 93
AsuC2I CCSGG 1 cut(s) 97
AvaII GGWCC 1 cut(s) 93
BalI TGGCCA 1 cut(s) 22
BcnI CCSGG 1 cut(s) 97
Bme1390I CCNGG 1 cut(s) 97
Bme18I GGWCC 1 cut(s) 93
BmgT120I GGNCC 1 cut(s) 93
BmiI GGNNCC 1 cut(s) 95
BmrFI CCNGG 1 cut(s) 97
BmsI GCATC 2 cut(s) 41, 92
BpuMI CCSGG 1 cut(s) 97
Bsa29I ATCGAT 1 cut(s) 244
BsaAI YACGTR 1 cut(s) 116
Bse1I ACTGG 1 cut(s) 23
BseCI ATCGAT 1 cut(s) 244
BseGI GGATG 2 cut(s) 32, 68
BseNI ACTGG 1 cut(s) 23
BshFI GGCC 1 cut(s) 22
BshVI ATCGAT 1 cut(s) 244
BsiSI CCGG 1 cut(s) 97
BslFI GGGAC 1 cut(s) 79
BsmFI GGGAC 1 cut(s) 79
BsnI GGCC 1 cut(s) 22
Bsp143I GATC 3 cut(s) 156, 210, 241
BspANI GGCC 1 cut(s) 22
BspDI ATCGAT 1 cut(s) 244
BspLI GGNNCC 1 cut(s) 95
BspPI GGATC 1 cut(s) 151
BsrI ACTGG 1 cut(s) 23
BssMI GATC 3 cut(s) 156, 210, 241
BstBAI YACGTR 1 cut(s) 116
BstC8I GCNNGC 2 cut(s) 81, 192
BstDEI CTNAG 1 cut(s) 238
BstF5I GGATG 2 cut(s) 32, 68
BstKTI GATC 3 cut(s) 159, 213, 244
BstMBI GATC 3 cut(s) 156, 210, 241
BstSCI CCNGG 1 cut(s) 95
BstX2I RGATCY 1 cut(s) 156
BstYI RGATCY 1 cut(s) 156
Bsu15I ATCGAT 1 cut(s) 244
BsuRI GGCC 1 cut(s) 22
BsuTUI ATCGAT 1 cut(s) 244
BtsCI GGATG 2 cut(s) 32, 68
BtsIMutI CAGTG 1 cut(s) 30
Cac8I GCNNGC 2 cut(s) 81, 192
Cfr13I GGNCC 1 cut(s) 93
ClaI ATCGAT 1 cut(s) 244
CviAII CATG 2 cut(s) 18, 40
CviJI RGCY 4 cut(s) 22, 190, 204, 237
CviKI_1 RGCY 4 cut(s) 22, 190, 204, 237
DdeI CTNAG 1 cut(s) 238
DpnI GATC 3 cut(s) 158, 212, 243
DpnII GATC 3 cut(s) 156, 210, 241
EaeI YGGCCR 1 cut(s) 20
Eco47I GGWCC 1 cut(s) 93
EcoO109I RGGNCCY 1 cut(s) 93
FaeI CATG 2 cut(s) 21, 43
FaiI YATR 2 cut(s) 19, 41
FalI AAGNNNNNCTT 2 cut(s) 56, 88
FaqI GGGAC 1 cut(s) 79
FatI CATG 2 cut(s) 17, 39
FblI GTMKAC 1 cut(s) 104
FokI GGATG 2 cut(s) 19, 55
HaeIII GGCC 1 cut(s) 22
HapII CCGG 1 cut(s) 97
Hin1II CATG 2 cut(s) 21, 43
HpaII CCGG 1 cut(s) 97
Hpy166II GTNNAC 1 cut(s) 105
Hpy188I TCNGA 1 cut(s) 241
Hpy188III TCNNGA 3 cut(s) 125, 180, 214
Hpy8I GTNNAC 1 cut(s) 105
HpyCH4IV ACGT 1 cut(s) 115
HpyCH4V TGCA 2 cut(s) 32, 174
HpyF3I CTNAG 1 cut(s) 238
HpySE526I ACGT 1 cut(s) 115
Hsp92II CATG 2 cut(s) 21, 43
Kzo9I GATC 3 cut(s) 156, 210, 241
LpnPI CCDG 4 cut(s) 36, 110, 138, 204
LweI GCATC 2 cut(s) 41, 92
MaeII ACGT 1 cut(s) 115
MalI GATC 3 cut(s) 158, 212, 243
MboI GATC 3 cut(s) 156, 210, 241
MflI RGATCY 1 cut(s) 156
MlsI TGGCCA 1 cut(s) 22
MluNI TGGCCA 1 cut(s) 22
MmeI TCCRAC 1 cut(s) 132
MnlI CCTC 3 cut(s) 25, 84, 229
Mox20I TGGCCA 1 cut(s) 22
MscI TGGCCA 1 cut(s) 22
MseI TTAA 1 cut(s) 134
Msp20I TGGCCA 1 cut(s) 22
MspI CCGG 1 cut(s) 97
MspR9I CCNGG 1 cut(s) 97
NciI CCSGG 1 cut(s) 97
NdeII GATC 3 cut(s) 156, 210, 241
NlaIII CATG 2 cut(s) 21, 43
NlaIV GGNNCC 1 cut(s) 95
PfoI TCCNGGA 1 cut(s) 95
Ppu21I YACGTR 1 cut(s) 116
PpuMI RGGWCCY 1 cut(s) 93
Psp5II RGGWCCY 1 cut(s) 93
PspN4I GGNNCC 1 cut(s) 95
PspPI GGNCC 1 cut(s) 93
PspPPI RGGWCCY 1 cut(s) 93
PsuI RGATCY 1 cut(s) 156
SaqAI TTAA 1 cut(s) 134
Sau3AI GATC 3 cut(s) 156, 210, 241
Sau96I GGNCC 1 cut(s) 93
ScrFI CCNGG 1 cut(s) 97
SetI ASST 5 cut(s) 95, 118, 206, 221, 239
SfaNI GCATC 2 cut(s) 41, 92
SinI GGWCC 1 cut(s) 93
StyD4I CCNGG 1 cut(s) 95
TaiI ACGT 1 cut(s) 118
TaqI TCGA 6 cut(s) 181, 197, 209, 215, 221, 244
Tru1I TTAA 1 cut(s) 134
Tru9I TTAA 1 cut(s) 134
TscAI CASTG 1 cut(s) 30
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 30
VpaK11BI GGWCC 1 cut(s) 93
XmiI GTMKAC 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.