pycom02g25450

Structural maintenance of chromosomes protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
OG0016957
Physical Location & Seq
Reverse (-)
23362001 .. 23362516
516 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom02g25450.2

Sequence Viewer

Length: 318 bp
ATGCTTGCCTCCCCTGATGTCTTCCACGTGAAACACTTGGTGGCCAGGCCTCAAATTTCGTTCATTGTTTTTCATGGCCTTGTTGGAGGATTCAGATATGAGTGTGCCACCGCTTATGGAATATATCACATTCACTTGGCATTGGTTATAGTTATCCCTTGGAGGGTGAAGGAGGAATTGATCAATCTTCCCTTCACGTGCCAAAGCTTCAATATGATCACAAAGGGAAGGGTGGTGCCTAAAATAGATGTAGTTGAAATCAGTCAAAGGTTTAATGTTCAAGTCAACAATTTAACTCAAGCGAGTTTCATTTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0000819 GO:0005575 GO:0005911 GO:0006996 GO:0007049 GO:0007059 GO:0007062 GO:0008150 GO:0009506 GO:0009987 GO:0016043 GO:0022402 GO:0030054 GO:0051276 GO:0055044 GO:0071840 GO:0098813
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AAA_23 SMC_N

Protein Analysis

106

Amino Acids

11.97

Weight (kDa)

9.14

Isoelectric Point (pI)

35.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 316
AccB1I GGYRCC 1 cut(s) 235
AciI CCGC 1 cut(s) 111
AcoI YGGCCR 1 cut(s) 42
AcsI RAATTY 1 cut(s) 54
AcvI CACGTG 2 cut(s) 28, 198
AdeI CACNNNGTG 1 cut(s) 40
AfiI CCNNNNNNNGG 1 cut(s) 163
AgsI TTSAA 3 cut(s) 211, 257, 281
AjnI CCWGG 1 cut(s) 44
AluBI AGCT 1 cut(s) 207
AluI AGCT 1 cut(s) 207
AoxI GGCC 3 cut(s) 42, 47, 76
ApoI RAATTY 1 cut(s) 54
AsuHPI GGTGA 1 cut(s) 178
BalI TGGCCA 1 cut(s) 44
BanI GGYRCC 1 cut(s) 235
BbrPI CACGTG 2 cut(s) 28, 198
BbsI GAAGAC 1 cut(s) 13
BciT130I CCWGG 1 cut(s) 46
BclI TGATCA 2 cut(s) 180, 216
Bme1390I CCNGG 1 cut(s) 46
BmiI GGNNCC 1 cut(s) 237
BmrFI CCNGG 1 cut(s) 46
BpiI GAAGAC 1 cut(s) 13
BpuEI CTTGAG 1 cut(s) 282
BsaAI YACGTR 2 cut(s) 28, 198
BsaJI CCNNGG 1 cut(s) 158
Bsc4I CCNNNNNNNGG 1 cut(s) 163
BseBI CCWGG 1 cut(s) 46
BseDI CCNNGG 1 cut(s) 158
BseLI CCNNNNNNNGG 1 cut(s) 163
BshFI GGCC 3 cut(s) 44, 49, 78
BshNI GGYRCC 1 cut(s) 235
BslI CCNNNNNNNGG 1 cut(s) 163
BsnI GGCC 3 cut(s) 44, 49, 78
Bsp143I GATC 2 cut(s) 180, 216
BspACI CCGC 1 cut(s) 111
BspANI GGCC 3 cut(s) 44, 49, 78
BspLI GGNNCC 1 cut(s) 237
BspT107I GGYRCC 1 cut(s) 235
BssECI CCNNGG 1 cut(s) 158
BssMI GATC 2 cut(s) 180, 216
BssT1I CCWWGG 1 cut(s) 158
Bst2UI CCWGG 1 cut(s) 46
BstBAI YACGTR 2 cut(s) 28, 198
BstC8I GCNNGC 1 cut(s) 6
BstKTI GATC 2 cut(s) 183, 219
BstMBI GATC 2 cut(s) 180, 216
BstNI CCWGG 1 cut(s) 46
BstSCI CCNGG 1 cut(s) 44
BstV2I GAAGAC 1 cut(s) 13
BsuRI GGCC 3 cut(s) 44, 49, 78
Cac8I GCNNGC 1 cut(s) 6
CviAII CATG 1 cut(s) 74
CviJI RGCY 4 cut(s) 44, 49, 78, 207
CviKI_1 RGCY 4 cut(s) 44, 49, 78, 207
DpnI GATC 2 cut(s) 182, 218
DpnII GATC 2 cut(s) 180, 216
DraIII CACNNNGTG 1 cut(s) 40
EaeI YGGCCR 1 cut(s) 42
Eco130I CCWWGG 1 cut(s) 158
Eco147I AGGCCT 1 cut(s) 49
Eco72I CACGTG 2 cut(s) 28, 198
EcoRII CCWGG 1 cut(s) 44
EcoT14I CCWWGG 1 cut(s) 158
ErhI CCWWGG 1 cut(s) 158
FaeI CATG 1 cut(s) 77
FaiI YATR 7 cut(s) 75, 99, 117, 124, 149, 215, 316
FatI CATG 1 cut(s) 73
FbaI TGATCA 2 cut(s) 180, 216
HaeIII GGCC 3 cut(s) 44, 49, 78
Hin1II CATG 1 cut(s) 77
HincII GTYRAC 1 cut(s) 286
HindII GTYRAC 1 cut(s) 286
HindIII AAGCTT 1 cut(s) 205
HinfI GANTC 1 cut(s) 90
HphI GGTGA 1 cut(s) 178
Hpy166II GTNNAC 1 cut(s) 286
Hpy188I TCNGA 1 cut(s) 95
Hpy8I GTNNAC 1 cut(s) 286
HpyAV CCTTC 3 cut(s) 163, 202, 222
HpyCH4IV ACGT 2 cut(s) 27, 197
HpySE526I ACGT 2 cut(s) 27, 197
Hsp92II CATG 1 cut(s) 77
Ksp22I TGATCA 2 cut(s) 180, 216
Kzo9I GATC 2 cut(s) 180, 216
LpnPI CCDG 3 cut(s) 27, 31, 58
MaeII ACGT 2 cut(s) 27, 197
MalI GATC 2 cut(s) 182, 218
MboI GATC 2 cut(s) 180, 216
MboII GAAGA 2 cut(s) 13, 179
MlsI TGGCCA 1 cut(s) 44
MluCI AATT 3 cut(s) 54, 176, 289
MluNI TGGCCA 1 cut(s) 44
MmeI TCCRAC 1 cut(s) 64
MnlI CCTC 5 cut(s) 19, 60, 80, 156, 166
Mox20I TGGCCA 1 cut(s) 44
MscI TGGCCA 1 cut(s) 44
MseI TTAA 2 cut(s) 273, 293
Msp20I TGGCCA 1 cut(s) 44
MspR9I CCNGG 1 cut(s) 46
MvaI CCWGG 1 cut(s) 46
NdeII GATC 2 cut(s) 180, 216
NlaIII CATG 1 cut(s) 77
NlaIV GGNNCC 1 cut(s) 237
PceI AGGCCT 1 cut(s) 49
PfeI GAWTC 1 cut(s) 90
PmaCI CACGTG 2 cut(s) 28, 198
PmlI CACGTG 2 cut(s) 28, 198
Ppu21I YACGTR 2 cut(s) 28, 198
PsiI TTATAA 1 cut(s) 316
Psp6I CCWGG 1 cut(s) 44
PspCI CACGTG 2 cut(s) 28, 198
PspGI CCWGG 1 cut(s) 44
PspN4I GGNNCC 1 cut(s) 237
SaqAI TTAA 2 cut(s) 273, 293
Sau3AI GATC 2 cut(s) 180, 216
ScrFI CCNGG 1 cut(s) 46
SetI ASST 4 cut(s) 30, 200, 209, 272
SmlI CTYRAG 1 cut(s) 297
SmoI CTYRAG 1 cut(s) 297
Sse9I AATT 3 cut(s) 54, 176, 289
SseBI AGGCCT 1 cut(s) 49
SsiI CCGC 1 cut(s) 111
StuI AGGCCT 1 cut(s) 49
StyD4I CCNGG 1 cut(s) 44
StyI CCWWGG 1 cut(s) 158
TaiI ACGT 2 cut(s) 30, 200
TasI AATT 3 cut(s) 54, 176, 289
TfiI GAWTC 1 cut(s) 90
Tru1I TTAA 2 cut(s) 273, 293
Tru9I TTAA 2 cut(s) 273, 293
TspDTI ATGAA 3 cut(s) 52, 62, 298
XapI RAATTY 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.