pycom03g03480

disease resistance protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
OG0018131
Physical Location & Seq
Reverse (-)
2779324 .. 2780313
990 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g03480.3

Sequence Viewer

Length: 468 bp
ATGGTTGATGTAAGCGAGGTTGTGGAATTTCCATTGGTTGATAAAAAACAAATTTTTAATCTCCAAATTGATTGGTGGACTCTGTTGAGTCTGTCCCCTACGACTCCAGAGAGTAGTCTTCAAATATTGAATGCCTTGCAACCGCAAGAAGATCTGGAATCTTTAGGCATCAATGGGGTTGTGGCTCCCACCTGGCCGAGATGGTTGACGGATTTAAACATGTTGAGATTCCTTACTCTTGGTCATTGTGTAAATTGGAAAAATGTGCCTCCTCTTGGTAAATTGCCCTTCCTTGAAAGACTGAAGCTATCGGAGATGAGGCTCATAGAAAAGGTTGGTGGTGAATTTTTGGGACTAGAAGACGACCAAAAGCCACTGTTGTGTGTTGCTATATTAGACAAACATATTTTAGTAAAAATATTTGTTCATATCGTTTCAGGTATTCTAGTGATGAAGCTAAAGGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

156

Amino Acids

17.58

Weight (kDa)

5.59

Isoelectric Point (pI)

44.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 143
AcoI YGGCCR 1 cut(s) 194
AcsI RAATTY 3 cut(s) 26, 51, 344
AcuI CTGAAG 1 cut(s) 323
AfiI CCNNNNNNNGG 1 cut(s) 275
AflIII ACRYGT 1 cut(s) 219
AgsI TTSAA 3 cut(s) 122, 130, 296
AjnI CCWGG 1 cut(s) 191
AleI CACNNNNGTG 1 cut(s) 379
AluBI AGCT 2 cut(s) 307, 457
AluI AGCT 2 cut(s) 307, 457
AoxI GGCC 1 cut(s) 194
ApoI RAATTY 3 cut(s) 26, 51, 344
AsuHPI GGTGA 1 cut(s) 353
BbsI GAAGAC 2 cut(s) 110, 366
BccI CCATC 1 cut(s) 195
BciT130I CCWGG 1 cut(s) 193
BfaI CTAG 2 cut(s) 356, 446
BglII AGATCT 1 cut(s) 151
Bme1390I CCNGG 1 cut(s) 193
BmiI GGNNCC 1 cut(s) 186
BmrFI CCNGG 1 cut(s) 193
BmsI GCATC 1 cut(s) 177
BpiI GAAGAC 2 cut(s) 110, 366
BpmI CTGGAG 1 cut(s) 90
Bsc4I CCNNNNNNNGG 1 cut(s) 275
BseBI CCWGG 1 cut(s) 193
BseLI CCNNNNNNNGG 1 cut(s) 275
BseRI GAGGAG 1 cut(s) 261
BshFI GGCC 1 cut(s) 196
BslFI GGGAC 2 cut(s) 79, 366
BslI CCNNNNNNNGG 1 cut(s) 275
BsmFI GGGAC 2 cut(s) 79, 366
BsmI GAATGC 1 cut(s) 136
BsnI GGCC 1 cut(s) 196
Bsp143I GATC 1 cut(s) 151
BspACI CCGC 1 cut(s) 143
BspANI GGCC 1 cut(s) 196
BspLI GGNNCC 1 cut(s) 186
BssMI GATC 1 cut(s) 151
Bst2UI CCWGG 1 cut(s) 193
Bst4CI ACNGT 1 cut(s) 378
BstKTI GATC 1 cut(s) 154
BstMBI GATC 1 cut(s) 151
BstNI CCWGG 1 cut(s) 193
BstNSI RCATGY 1 cut(s) 223
BstSCI CCNGG 1 cut(s) 191
BstV2I GAAGAC 2 cut(s) 110, 366
BstX2I RGATCY 1 cut(s) 151
BstYI RGATCY 1 cut(s) 151
BsuRI GGCC 1 cut(s) 196
BtsIMutI CAGTG 1 cut(s) 374
CviAII CATG 1 cut(s) 220
CviJI RGCY 6 cut(s) 185, 196, 307, 322, 373, 457
CviKI_1 RGCY 6 cut(s) 185, 196, 307, 322, 373, 457
DpnI GATC 1 cut(s) 153
DpnII GATC 1 cut(s) 151
DraI TTTAAA 1 cut(s) 216
EaeI YGGCCR 1 cut(s) 194
Eco57I CTGAAG 1 cut(s) 323
EcoRII CCWGG 1 cut(s) 191
FaeI CATG 1 cut(s) 223
FaiI YATR 5 cut(s) 221, 326, 392, 405, 429
FaqI GGGAC 2 cut(s) 79, 366
FatI CATG 1 cut(s) 219
FspBI CTAG 2 cut(s) 356, 446
GsuI CTGGAG 1 cut(s) 90
HaeIII GGCC 1 cut(s) 196
Hin1II CATG 1 cut(s) 223
HincII GTYRAC 1 cut(s) 207
HindII GTYRAC 1 cut(s) 207
HinfI GANTC 5 cut(s) 79, 88, 103, 158, 228
HphI GGTGA 1 cut(s) 353
Hpy166II GTNNAC 2 cut(s) 78, 207
Hpy188I TCNGA 1 cut(s) 313
Hpy188III TCNNGA 2 cut(s) 107, 155
Hpy8I GTNNAC 2 cut(s) 78, 207
HpyAV CCTTC 1 cut(s) 298
HpyCH4III ACNGT 1 cut(s) 378
HpyCH4V TGCA 1 cut(s) 139
Hsp92II CATG 1 cut(s) 223
Kzo9I GATC 1 cut(s) 151
LmnI GCTCC 1 cut(s) 190
LpnPI CCDG 5 cut(s) 120, 140, 178, 205, 423
LweI GCATC 1 cut(s) 177
MaeI CTAG 2 cut(s) 356, 446
MalI GATC 1 cut(s) 153
MboI GATC 1 cut(s) 151
MboII GAAGA 3 cut(s) 110, 161, 371
MflI RGATCY 1 cut(s) 151
MluCI AATT 6 cut(s) 26, 51, 66, 253, 281, 344
MlyI GAGTC 3 cut(s) 73, 97, 97
MnlI CCTC 4 cut(s) 10, 279, 282, 312
MseI TTAA 2 cut(s) 57, 215
MslI CAYNNNNRTG 1 cut(s) 379
MspR9I CCNGG 1 cut(s) 193
Mva1269I GAATGC 1 cut(s) 136
MvaI CCWGG 1 cut(s) 193
NdeII GATC 1 cut(s) 151
NlaIII CATG 1 cut(s) 223
NlaIV GGNNCC 1 cut(s) 186
NmeAIII GCCGAG 1 cut(s) 222
NspI RCATGY 1 cut(s) 223
OliI CACNNNNGTG 1 cut(s) 379
PciI ACATGT 1 cut(s) 219
PctI GAATGC 1 cut(s) 136
PfeI GAWTC 2 cut(s) 158, 228
PleI GAGTC 3 cut(s) 73, 96, 97
PpsI GAGTC 3 cut(s) 73, 96, 97
PscI ACATGT 1 cut(s) 219
Psp6I CCWGG 1 cut(s) 191
PspGI CCWGG 1 cut(s) 191
PspN4I GGNNCC 1 cut(s) 186
PsuI RGATCY 1 cut(s) 151
RseI CAYNNNNRTG 1 cut(s) 379
SaqAI TTAA 2 cut(s) 57, 215
Sau3AI GATC 1 cut(s) 151
SchI GAGTC 3 cut(s) 73, 97, 97
ScrFI CCNGG 1 cut(s) 193
SetI ASST 6 cut(s) 21, 194, 309, 336, 442, 459
SfaNI GCATC 1 cut(s) 177
SmiMI CAYNNNNRTG 1 cut(s) 379
Sse9I AATT 6 cut(s) 26, 51, 66, 253, 281, 344
SsiI CCGC 1 cut(s) 143
SspI AATATT 2 cut(s) 126, 420
SspMI CTAG 2 cut(s) 356, 446
StyD4I CCNGG 1 cut(s) 191
TaaI ACNGT 1 cut(s) 378
TasI AATT 6 cut(s) 26, 51, 66, 253, 281, 344
TfiI GAWTC 2 cut(s) 158, 228
Tru1I TTAA 2 cut(s) 57, 215
Tru9I TTAA 2 cut(s) 57, 215
TscAI CASTG 1 cut(s) 381
TspDTI ATGAA 2 cut(s) 416, 467
TspGWI ACGGA 1 cut(s) 224
TspRI CASTG 1 cut(s) 381
XapI RAATTY 3 cut(s) 26, 51, 344
XceI RCATGY 1 cut(s) 223
XspI CTAG 2 cut(s) 356, 446
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.