Rmu_sc0000851.1_g000007

disease resistance protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000851.1
OG0018131
Physical Location & Seq
Forward (+)
22395 .. 22868
474 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000851.1_g000007.1.cds

Sequence Viewer

Length: 474 bp
atggaccagcttcaggggagccttatgatatctggattggggaataaggatgatgcgagtgagattgagaaagcacagttggggaataaggagcacctctctgatttgggagtatggttccaggaagaatatggaaagcagagaaaaggcgatgaagaaatagtgaaagcattgcaaccacatcaaaatttggaatctttagacatttggggttgccatggcaccaccgagtctctctattggatcaagtctttacgcaatttgagaaaacttgttctcgatgggtggagattttgtgaatttttgcctcctcttggaaaattgccatcgcttgaaattctggagatatcggggatgaagaaagtgaaaaaggtgggagttgaatttctgggaatagaagaagaagaagaacaagtctcaggaattctattccccaaattgaaacaactttggttccaatcgatggagaactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

157

Amino Acids

17.99

Weight (kDa)

5.07

Isoelectric Point (pI)

57.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 221
AccB7I CCANNNNNTGG 1 cut(s) 463
AclWI GGATC 1 cut(s) 251
AcsI RAATTY 5 cut(s) 187, 299, 336, 383, 423
AfiI CCNNNNNNNGG 3 cut(s) 13, 314, 463
AgsI TTSAA 3 cut(s) 335, 383, 442
AjnI CCWGG 1 cut(s) 120
AjuI GAANNNNNNNTTGG 2 cut(s) 62, 94
AluBI AGCT 1 cut(s) 10
AluI AGCT 1 cut(s) 10
Alw21I GWGCWC 1 cut(s) 96
Alw26I GTCTC 2 cut(s) 237, 421
AlwI GGATC 1 cut(s) 251
ApoI RAATTY 5 cut(s) 187, 299, 336, 383, 423
AspS9I GGNCC 1 cut(s) 4
AvaII GGWCC 1 cut(s) 4
BanI GGYRCC 1 cut(s) 221
Bbv12I GWGCWC 1 cut(s) 96
BccI CCATC 3 cut(s) 275, 334, 457
BciT130I CCWGG 1 cut(s) 122
BcoDI GTCTC 2 cut(s) 237, 421
Bme1390I CCNGG 1 cut(s) 122
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 4 cut(s) 20, 119, 223, 455
BmrFI CCNGG 1 cut(s) 122
BmsI GCATC 1 cut(s) 43
BplI GAGNNNNNCTC 2 cut(s) 83, 115
BpmI CTGGAG 1 cut(s) 362
Bsa29I ATCGAT 1 cut(s) 461
BsaJI CCNNGG 1 cut(s) 217
BsaXI ACNNNNNCTCC 2 cut(s) 280, 310
Bsc4I CCNNNNNNNGG 3 cut(s) 13, 314, 463
Bse3DI GCAATG 1 cut(s) 170
BseBI CCWGG 1 cut(s) 122
BseCI ATCGAT 1 cut(s) 461
BseDI CCNNGG 1 cut(s) 217
BseGI GGATG 2 cut(s) 55, 360
BseLI CCNNNNNNNGG 3 cut(s) 13, 314, 463
BseMI GCAATG 1 cut(s) 170
BseMII CTCAG 1 cut(s) 432
BseRI GAGGAG 1 cut(s) 300
BshNI GGYRCC 1 cut(s) 221
BshVI ATCGAT 1 cut(s) 461
BsiHKAI GWGCWC 1 cut(s) 96
BslI CCNNNNNNNGG 3 cut(s) 13, 314, 463
BsmAI GTCTC 2 cut(s) 237, 421
Bsp1286I GDGCHC 1 cut(s) 96
Bsp143I GATC 1 cut(s) 243
Bsp19I CCATGG 1 cut(s) 217
BspCNI CTCAG 1 cut(s) 431
BspDI ATCGAT 1 cut(s) 461
BspLI GGNNCC 4 cut(s) 20, 119, 223, 455
BspPI GGATC 1 cut(s) 251
BspT107I GGYRCC 1 cut(s) 221
BsrDI GCAATG 1 cut(s) 170
BssECI CCNNGG 1 cut(s) 217
BssMI GATC 1 cut(s) 243
BssT1I CCWWGG 1 cut(s) 217
Bst2UI CCWGG 1 cut(s) 122
Bst4CI ACNGT 1 cut(s) 78
BstDEI CTNAG 1 cut(s) 418
BstDSI CCRYGG 1 cut(s) 217
BstF5I GGATG 2 cut(s) 55, 360
BstKTI GATC 1 cut(s) 246
BstMAI GTCTC 2 cut(s) 237, 421
BstMBI GATC 1 cut(s) 243
BstNI CCWGG 1 cut(s) 122
BstSCI CCNGG 1 cut(s) 120
Bsu15I ATCGAT 1 cut(s) 461
BsuTUI ATCGAT 1 cut(s) 461
BtgI CCRYGG 1 cut(s) 217
BtgZI GCGATG 2 cut(s) 165, 312
BtsCI GGATG 2 cut(s) 55, 360
Cfr13I GGNCC 1 cut(s) 4
ClaI ATCGAT 1 cut(s) 461
CviAII CATG 1 cut(s) 218
CviJI RGCY 2 cut(s) 10, 21
CviKI_1 RGCY 2 cut(s) 10, 21
DdeI CTNAG 1 cut(s) 418
DpnI GATC 1 cut(s) 245
DpnII GATC 1 cut(s) 243
Eco130I CCWWGG 1 cut(s) 217
Eco32I GATATC 2 cut(s) 30, 348
Eco47I GGWCC 1 cut(s) 4
EcoRI GAATTC 1 cut(s) 423
EcoRII CCWGG 1 cut(s) 120
EcoRV GATATC 2 cut(s) 30, 348
EcoT14I CCWWGG 1 cut(s) 217
ErhI CCWWGG 1 cut(s) 217
FaeI CATG 1 cut(s) 221
FaiI YATR 4 cut(s) 26, 115, 132, 219
FatI CATG 1 cut(s) 217
FokI GGATG 2 cut(s) 62, 367
GsuI CTGGAG 1 cut(s) 362
Hin1II CATG 1 cut(s) 221
HinfI GANTC 2 cut(s) 194, 230
Hpy188I TCNGA 1 cut(s) 103
Hpy188III TCNNGA 4 cut(s) 33, 278, 341, 420
HpyCH4III ACNGT 1 cut(s) 78
HpyCH4V TGCA 1 cut(s) 175
HpyF3I CTNAG 1 cut(s) 418
Hsp92II CATG 1 cut(s) 221
Kzo9I GATC 1 cut(s) 243
LmnI GCTCC 2 cut(s) 18, 91
LpnPI CCDG 7 cut(s) 18, 20, 107, 134, 326, 374, 405
LweI GCATC 1 cut(s) 43
MalI GATC 1 cut(s) 245
MboI GATC 1 cut(s) 243
MboII GAAGA 7 cut(s) 137, 167, 370, 410, 413, 416, 419
MhlI GDGCHC 1 cut(s) 96
MluCI AATT 8 cut(s) 187, 259, 299, 320, 336, 383, 423, 437
MlyI GAGTC 1 cut(s) 239
MnlI CCTC 3 cut(s) 107, 318, 321
MspR9I CCNGG 1 cut(s) 122
MvaI CCWGG 1 cut(s) 122
NcoI CCATGG 1 cut(s) 217
NdeII GATC 1 cut(s) 243
NlaIII CATG 1 cut(s) 221
NlaIV GGNNCC 4 cut(s) 20, 119, 223, 455
PfeI GAWTC 1 cut(s) 194
PflMI CCANNNNNTGG 1 cut(s) 463
PfoI TCCNGGA 1 cut(s) 120
PleI GAGTC 1 cut(s) 238
PpsI GAGTC 1 cut(s) 238
Psp6I CCWGG 1 cut(s) 120
PspGI CCWGG 1 cut(s) 120
PspN4I GGNNCC 4 cut(s) 20, 119, 223, 455
PspPI GGNCC 1 cut(s) 4
Sau3AI GATC 1 cut(s) 243
Sau96I GGNCC 1 cut(s) 4
SchI GAGTC 1 cut(s) 239
ScrFI CCNGG 1 cut(s) 122
SduI GDGCHC 1 cut(s) 96
SetI ASST 3 cut(s) 12, 99, 375
SfaNI GCATC 1 cut(s) 43
SinI GGWCC 1 cut(s) 4
Sse9I AATT 8 cut(s) 187, 259, 299, 320, 336, 383, 423, 437
StyD4I CCNGG 1 cut(s) 120
StyI CCWWGG 1 cut(s) 217
TaaI ACNGT 1 cut(s) 78
TaqI TCGA 2 cut(s) 279, 461
TasI AATT 8 cut(s) 187, 259, 299, 320, 336, 383, 423, 437
TfiI GAWTC 1 cut(s) 194
TspDTI ATGAA 2 cut(s) 168, 371
Van91I CCANNNNNTGG 1 cut(s) 463
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 5 cut(s) 187, 299, 336, 383, 423
XcmI CCANNNNNNNNNTGG 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.