Rh5AG061800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
5242867 .. 5244776
1910 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG061800.1

Sequence Viewer

Length: 156 bp
ATGCCTGTCTGGCCCGAGAACTGTGAGGTCGAAATTTCTCACTATGAGGAGGATCCGGTAATACCGGATGTTTCTGAGAGTGATGAAACAGAGATACAGAGAGATGGTGATGAAACTGAGATACAGAGAGATGAGGAGATCACCATCATCACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.96

Weight (kDa)

4.05

Isoelectric Point (pI)

80.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 47, 60
AcsI RAATTY 1 cut(s) 33
AlwI GGATC 2 cut(s) 47, 60
Ama87I CYCGRG 1 cut(s) 14
AoxI GGCC 1 cut(s) 11
ApoI RAATTY 1 cut(s) 33
AspS9I GGNCC 1 cut(s) 12
AsuHPI GGTGA 3 cut(s) 119, 133, 142
AvaI CYCGRG 1 cut(s) 14
BamHI GGATCC 1 cut(s) 52
BccI CCATC 2 cut(s) 98, 152
BglI GCCNNNNNGGC 1 cut(s) 10
BmeT110I CYCGRG 1 cut(s) 14
BmgT120I GGNCC 1 cut(s) 12
BmiI GGNNCC 1 cut(s) 54
BsaBI GATNNNNATC 1 cut(s) 143
BsaWI WCCGGW 2 cut(s) 55, 64
Bse8I GATNNNNATC 1 cut(s) 143
BseGI GGATG 1 cut(s) 73
BseJI GATNNNNATC 1 cut(s) 143
BseMII CTCAG 2 cut(s) 66, 108
BseRI GAGGAG 2 cut(s) 62, 149
BshFI GGCC 1 cut(s) 13
BsiHKCI CYCGRG 1 cut(s) 14
BsiSI CCGG 2 cut(s) 56, 65
BsnI GGCC 1 cut(s) 13
BsoBI CYCGRG 1 cut(s) 14
Bsp143I GATC 2 cut(s) 52, 138
BspANI GGCC 1 cut(s) 13
BspCNI CTCAG 2 cut(s) 67, 109
BspLI GGNNCC 1 cut(s) 54
BspPI GGATC 2 cut(s) 47, 60
BssMI GATC 2 cut(s) 52, 138
Bst4CI ACNGT 1 cut(s) 23
BstDEI CTNAG 2 cut(s) 75, 117
BstF5I GGATG 1 cut(s) 73
BstKTI GATC 2 cut(s) 55, 141
BstMBI GATC 2 cut(s) 52, 138
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstX2I RGATCY 1 cut(s) 52
BstYI RGATCY 1 cut(s) 52
BsuRI GGCC 1 cut(s) 13
BtsCI GGATG 1 cut(s) 73
Cfr13I GGNCC 1 cut(s) 12
CviJI RGCY 1 cut(s) 13
CviKI_1 RGCY 1 cut(s) 13
DdeI CTNAG 2 cut(s) 75, 117
DpnI GATC 2 cut(s) 54, 140
DpnII GATC 2 cut(s) 52, 138
Eco88I CYCGRG 1 cut(s) 14
FaiI YATR 1 cut(s) 45
FokI GGATG 1 cut(s) 80
HaeIII GGCC 1 cut(s) 13
HapII CCGG 2 cut(s) 56, 65
HpaII CCGG 2 cut(s) 56, 65
HphI GGTGA 3 cut(s) 119, 133, 142
Hpy188I TCNGA 1 cut(s) 76
HpyCH4III ACNGT 1 cut(s) 23
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
HpyF3I CTNAG 2 cut(s) 75, 117
Kzo9I GATC 2 cut(s) 52, 138
LpnPI CCDG 3 cut(s) 18, 69, 78
MalI GATC 2 cut(s) 54, 140
MboI GATC 2 cut(s) 52, 138
MflI RGATCY 1 cut(s) 52
MluCI AATT 1 cut(s) 33
MnlI CCTC 4 cut(s) 19, 40, 43, 127
MspI CCGG 2 cut(s) 56, 65
MwoI GCNNNNNNNGC 1 cut(s) 10
NdeII GATC 2 cut(s) 52, 138
NlaIV GGNNCC 1 cut(s) 54
PspN4I GGNNCC 1 cut(s) 54
PspPI GGNCC 1 cut(s) 12
PsuI RGATCY 1 cut(s) 52
Sau3AI GATC 2 cut(s) 52, 138
Sau96I GGNCC 1 cut(s) 12
SetI ASST 2 cut(s) 30, 155
SgeI CNNG 6 cut(s) 17, 22, 26, 28, 68, 77
Sse9I AATT 1 cut(s) 33
TaaI ACNGT 1 cut(s) 23
TaqI TCGA 1 cut(s) 30
TasI AATT 1 cut(s) 33
TspDTI ATGAA 2 cut(s) 99, 126
XapI RAATTY 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.