pycom07g21990

Phosphodiesterase responsible for the U6 snRNA 3' end processing. Acts as an exoribonuclease (RNase) responsible for trimming the poly(U) tract of the last nucleotides in the pre-U6 snRNA molecule, leading to the formation of mature U6 snRNA

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Forward (+)
23447837 .. 23448300
464 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g21990.2

Sequence Viewer

Length: 252 bp
ATGCACGCTGTGAATGAGGTGTATAAGCTTCACAATCTTCCTGAATTTTACAAGGATCCGCGCCCTCACATATCGGTAGCTTGGGCATTGGGTGACATCAGCAATTCCGTGAAGAAAGTGGTTGAAGAAGAAAGACGAAGGTCTACCATCGGAGGATCGTTACAGAAATGTATTTTTACCAGTAACTTCAATGGTATCGAATGTAGGATTGGTAATAAAACACACAAAATATGTAAATTTTCTGAAGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.53

Weight (kDa)

8.88

Isoelectric Point (pI)

77.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 143
AccII CGCG 1 cut(s) 61
AciI CCGC 1 cut(s) 59
AclWI GGATC 3 cut(s) 50, 63, 163
AcsI RAATTY 2 cut(s) 44, 236
AdeI CACNNNGTG 1 cut(s) 10
AgsI TTSAA 2 cut(s) 125, 190
AjuI GAANNNNNNNTTGG 2 cut(s) 192, 224
AluBI AGCT 2 cut(s) 28, 80
AluI AGCT 2 cut(s) 28, 80
AlwI GGATC 3 cut(s) 50, 63, 163
ApoI RAATTY 2 cut(s) 44, 236
AspLEI GCGC 1 cut(s) 63
AsuHPI GGTGA 1 cut(s) 104
BamHI GGATCC 1 cut(s) 55
BccI CCATC 1 cut(s) 155
BmiI GGNNCC 1 cut(s) 57
BoxI GACNNNNGTC 1 cut(s) 139
Bse1I ACTGG 1 cut(s) 180
BseNI ACTGG 1 cut(s) 180
Bsh1236I CGCG 1 cut(s) 61
Bsp143I GATC 2 cut(s) 55, 155
BspACI CCGC 1 cut(s) 59
BspFNI CGCG 1 cut(s) 61
BspLI GGNNCC 1 cut(s) 57
BspPI GGATC 3 cut(s) 50, 63, 163
BsrI ACTGG 1 cut(s) 180
BssMI GATC 2 cut(s) 55, 155
BstC8I GCNNGC 1 cut(s) 6
BstFNI CGCG 1 cut(s) 61
BstHHI GCGC 1 cut(s) 63
BstKTI GATC 2 cut(s) 58, 158
BstMBI GATC 2 cut(s) 55, 155
BstPAI GACNNNNGTC 1 cut(s) 139
BstUI CGCG 1 cut(s) 61
BstX2I RGATCY 1 cut(s) 55
BstYI RGATCY 1 cut(s) 55
Cac8I GCNNGC 1 cut(s) 6
CfoI GCGC 1 cut(s) 63
CviJI RGCY 2 cut(s) 28, 80
CviKI_1 RGCY 2 cut(s) 28, 80
DpnI GATC 2 cut(s) 57, 157
DpnII GATC 2 cut(s) 55, 155
DraIII CACNNNGTG 1 cut(s) 10
FaiI YATR 3 cut(s) 24, 71, 232
FblI GTMKAC 1 cut(s) 143
GlaI GCGC 1 cut(s) 62
HhaI GCGC 1 cut(s) 63
Hin6I GCGC 1 cut(s) 61
HinP1I GCGC 1 cut(s) 61
HindIII AAGCTT 1 cut(s) 26
HphI GGTGA 1 cut(s) 104
Hpy166II GTNNAC 1 cut(s) 144
Hpy188I TCNGA 2 cut(s) 152, 244
Hpy188III TCNNGA 1 cut(s) 41
Hpy8I GTNNAC 1 cut(s) 144
HpyAV CCTTC 1 cut(s) 132
HpyCH4V TGCA 1 cut(s) 4
HspAI GCGC 1 cut(s) 61
Kzo9I GATC 2 cut(s) 55, 155
LpnPI CCDG 2 cut(s) 54, 193
MaeIII GTNAC 3 cut(s) 92, 159, 182
MalI GATC 2 cut(s) 57, 157
MboI GATC 2 cut(s) 55, 155
MboII GAAGA 4 cut(s) 29, 124, 137, 140
MflI RGATCY 1 cut(s) 55
MluCI AATT 3 cut(s) 44, 103, 236
MnlI CCTC 3 cut(s) 10, 75, 146
MvnI CGCG 1 cut(s) 61
NdeII GATC 2 cut(s) 55, 155
NlaIV GGNNCC 1 cut(s) 57
NmuCI GTSAC 1 cut(s) 92
PshAI GACNNNNGTC 1 cut(s) 139
PspN4I GGNNCC 1 cut(s) 57
PsuI RGATCY 1 cut(s) 55
Sau3AI GATC 2 cut(s) 55, 155
SetI ASST 4 cut(s) 21, 30, 82, 143
SgeI CNNG 7 cut(s) 17, 53, 64, 72, 93, 121, 192
Sse9I AATT 3 cut(s) 44, 103, 236
SsiI CCGC 1 cut(s) 59
TaqI TCGA 1 cut(s) 198
TasI AATT 3 cut(s) 44, 103, 236
TseFI GTSAC 1 cut(s) 92
Tsp45I GTSAC 1 cut(s) 92
TspGWI ACGGA 1 cut(s) 97
XapI RAATTY 2 cut(s) 44, 236
XmiI GTMKAC 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.