pycom08g09370

Thioredoxin-related transmembrane protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
Physical Location & Seq
Reverse (-)
7652824 .. 7653230
407 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom08g09370.2

Sequence Viewer

Length: 348 bp
ATGCACTGTGATAGTATACGAAAGAGAGTTGCAATGTTAGCATTCTTTCCTTTGATATATTTAATATGGCATATTTGGCAGATTGAATTTCGTGCCTCTTACTCTCCTGCTTGGATACGCTCAAGTCGGTGCTTTCCTGAGCTTTCAATTACGTATGTTTCCCACCAGTTACCTCTAAATCCGAAGTACATAATATATCTTCTATGTAGGAGCATGGGCCAACTTCCTACCTATGTCTTATTCACGAACGGAGCTGAAGTTGCACGGTATCCACAACTAGAATCTGAAGCAAAAGCATTTCGTGATCCCGTAACTAAGGTACTGGGACAAATTACATATCCAACATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

116

Amino Acids

13.47

Weight (kDa)

9.3

Isoelectric Point (pI)

58.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 16
AclWI GGATC 1 cut(s) 299
AcsI RAATTY 1 cut(s) 86
AcuI CTGAAG 2 cut(s) 276, 306
AfaI GTAC 2 cut(s) 188, 321
AgsI TTSAA 2 cut(s) 86, 147
AluBI AGCT 2 cut(s) 142, 254
AluI AGCT 2 cut(s) 142, 254
AlwI GGATC 1 cut(s) 299
AoxI GGCC 1 cut(s) 217
ApoI RAATTY 1 cut(s) 86
AspS9I GGNCC 1 cut(s) 217
BciVI GTATCC 2 cut(s) 108, 279
BfaI CTAG 1 cut(s) 278
BfuI GTATCC 2 cut(s) 108, 279
BmgT120I GGNCC 1 cut(s) 217
BmrI ACTGGG 1 cut(s) 332
BmuI ACTGGG 1 cut(s) 332
Bpu10I CCTNAGC 1 cut(s) 138
BpuEI CTTGAG 1 cut(s) 106
BsaAI YACGTR 1 cut(s) 153
BsaXI ACNNNNNCTCC 2 cut(s) 243, 273
Bse1I ACTGG 2 cut(s) 166, 327
Bse3DI GCAATG 1 cut(s) 39
BseMI GCAATG 1 cut(s) 39
BseMII CTCAG 1 cut(s) 129
BseNI ACTGG 2 cut(s) 166, 327
BshFI GGCC 1 cut(s) 219
BslFI GGGAC 1 cut(s) 339
BsmFI GGGAC 1 cut(s) 339
BsmI GAATGC 1 cut(s) 41
BsnI GGCC 1 cut(s) 219
Bsp143I GATC 1 cut(s) 304
BspANI GGCC 1 cut(s) 219
BspCNI CTCAG 1 cut(s) 130
BspPI GGATC 1 cut(s) 299
BsrDI GCAATG 1 cut(s) 39
BsrI ACTGG 2 cut(s) 166, 327
BssMI GATC 1 cut(s) 304
BssNAI GTATAC 1 cut(s) 17
Bst1107I GTATAC 1 cut(s) 17
Bst4CI ACNGT 2 cut(s) 8, 267
BstBAI YACGTR 1 cut(s) 153
BstDEI CTNAG 2 cut(s) 138, 315
BstKTI GATC 1 cut(s) 307
BstMBI GATC 1 cut(s) 304
BstMWI GCNNNNNNNGC 3 cut(s) 38, 76, 260
BstSNI TACGTA 1 cut(s) 153
BstZ17I GTATAC 1 cut(s) 17
BsuI GTATCC 2 cut(s) 108, 279
BsuRI GGCC 1 cut(s) 219
BtsIMutI CAGTG 1 cut(s) 4
Cfr13I GGNCC 1 cut(s) 217
Csp6I GTAC 2 cut(s) 187, 320
CviAII CATG 1 cut(s) 214
CviJI RGCY 3 cut(s) 142, 219, 254
CviKI_1 RGCY 3 cut(s) 142, 219, 254
CviQI GTAC 2 cut(s) 187, 320
DdeI CTNAG 2 cut(s) 138, 315
DpnI GATC 1 cut(s) 306
DpnII GATC 1 cut(s) 304
Eco105I TACGTA 1 cut(s) 153
Eco57I CTGAAG 2 cut(s) 276, 306
FaeI CATG 1 cut(s) 217
FaqI GGGAC 1 cut(s) 339
FatI CATG 1 cut(s) 213
FblI GTMKAC 1 cut(s) 16
FspBI CTAG 1 cut(s) 278
HaeIII GGCC 1 cut(s) 219
Hin1II CATG 1 cut(s) 217
HinfI GANTC 1 cut(s) 281
Hpy166II GTNNAC 1 cut(s) 17
Hpy188I TCNGA 2 cut(s) 183, 286
Hpy188III TCNNGA 3 cut(s) 137, 244, 302
Hpy8I GTNNAC 1 cut(s) 17
HpyCH4III ACNGT 2 cut(s) 8, 267
HpyCH4IV ACGT 1 cut(s) 152
HpyCH4V TGCA 3 cut(s) 4, 32, 263
HpyF10VI GCNNNNNNNGC 3 cut(s) 38, 76, 260
HpyF3I CTNAG 2 cut(s) 138, 315
HpySE526I ACGT 1 cut(s) 152
Hsp92II CATG 1 cut(s) 217
Kzo9I GATC 1 cut(s) 304
LmnI GCTCC 2 cut(s) 210, 251
LpnPI CCDG 4 cut(s) 120, 150, 179, 308
MaeI CTAG 1 cut(s) 278
MaeII ACGT 1 cut(s) 152
MaeIII GTNAC 2 cut(s) 168, 310
MalI GATC 1 cut(s) 306
MboI GATC 1 cut(s) 304
MboII GAAGA 1 cut(s) 191
MluCI AATT 3 cut(s) 86, 147, 330
MnlI CCTC 2 cut(s) 106, 183
MseI TTAA 1 cut(s) 62
Mva1269I GAATGC 1 cut(s) 41
MwoI GCNNNNNNNGC 3 cut(s) 38, 76, 260
NdeII GATC 1 cut(s) 304
NlaIII CATG 1 cut(s) 217
PctI GAATGC 1 cut(s) 41
PfeI GAWTC 1 cut(s) 281
Ppu21I YACGTR 1 cut(s) 153
PspPI GGNCC 1 cut(s) 217
RsaI GTAC 2 cut(s) 188, 321
RsaNI GTAC 2 cut(s) 187, 320
SaqAI TTAA 1 cut(s) 62
Sau3AI GATC 1 cut(s) 304
Sau96I GGNCC 1 cut(s) 217
SetI ASST 6 cut(s) 144, 155, 175, 233, 256, 321
SmlI CTYRAG 1 cut(s) 121
SmoI CTYRAG 1 cut(s) 121
SnaBI TACGTA 1 cut(s) 153
Sse9I AATT 3 cut(s) 86, 147, 330
SspMI CTAG 1 cut(s) 278
TaaI ACNGT 2 cut(s) 8, 267
TaiI ACGT 1 cut(s) 155
TasI AATT 3 cut(s) 86, 147, 330
TatI WGTACW 1 cut(s) 186
TfiI GAWTC 1 cut(s) 281
Tru1I TTAA 1 cut(s) 62
Tru9I TTAA 1 cut(s) 62
TspGWI ACGGA 1 cut(s) 264
XapI RAATTY 1 cut(s) 86
XmiI GTMKAC 1 cut(s) 16
XspI CTAG 1 cut(s) 278
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.