pycom110g00050

Thioredoxin-related transmembrane protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00000110
Physical Location & Seq
Reverse (-)
38570 .. 38782
213 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom110g00050.1

Sequence Viewer

Length: 213 bp
ATGGAGAAGAAGCAGAGCAAACCAATGGAGCTGTTAAACACGATGGTATCAGAGCCATACTATCTGCTCCATTTCTTGGCTTTTTTCTCCTACCTCGTCATCCGTACCTCCGCCTCCCACGTCCTCTCCGCCCACATCACCGATCACCTCCTCCACCGAGTAATTTTCCATCCCTTACTCTGTCTCTCTCTCCCTTTCCATTTTGATTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.21

Weight (kDa)

7.06

Isoelectric Point (pI)

37.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 76
AciI CCGC 2 cut(s) 111, 129
AfaI GTAC 1 cut(s) 106
AfiI CCNNNNNNNGG 1 cut(s) 76
AjiI CACGTC 1 cut(s) 121
AluBI AGCT 1 cut(s) 31
AluI AGCT 1 cut(s) 31
Alw26I GTCTC 1 cut(s) 188
AsuHPI GGTGA 2 cut(s) 130, 137
BaeI ACNNNNGTAYC 2 cut(s) 30, 63
BccI CCATC 2 cut(s) 37, 177
BcoDI GTCTC 1 cut(s) 188
BmgBI CACGTC 1 cut(s) 121
BsaXI ACNNNNNCTCC 2 cut(s) 110, 140
Bsc4I CCNNNNNNNGG 1 cut(s) 76
BseGI GGATG 2 cut(s) 99, 169
BseLI CCNNNNNNNGG 1 cut(s) 76
BseRI GAGGAG 1 cut(s) 140
BslI CCNNNNNNNGG 1 cut(s) 76
BsmAI GTCTC 1 cut(s) 188
Bsp143I GATC 1 cut(s) 142
BspACI CCGC 2 cut(s) 111, 129
BssMI GATC 1 cut(s) 142
BstF5I GGATG 2 cut(s) 99, 169
BstKTI GATC 1 cut(s) 145
BstMAI GTCTC 1 cut(s) 188
BstMBI GATC 1 cut(s) 142
BtrI CACGTC 1 cut(s) 121
BtsCI GGATG 2 cut(s) 99, 169
Csp6I GTAC 1 cut(s) 105
CviJI RGCY 3 cut(s) 31, 55, 80
CviKI_1 RGCY 3 cut(s) 31, 55, 80
CviQI GTAC 1 cut(s) 105
DpnI GATC 1 cut(s) 144
DpnII GATC 1 cut(s) 142
EciI GGCGGA 2 cut(s) 100, 118
FaiI YATR 2 cut(s) 58, 211
FokI GGATG 2 cut(s) 86, 156
HinfI GANTC 1 cut(s) 206
HphI GGTGA 2 cut(s) 130, 137
Hpy188I TCNGA 1 cut(s) 52
HpyCH4IV ACGT 1 cut(s) 120
HpySE526I ACGT 1 cut(s) 120
Kzo9I GATC 1 cut(s) 142
LmnI GCTCC 2 cut(s) 28, 72
MaeII ACGT 1 cut(s) 120
MalI GATC 1 cut(s) 144
MboI GATC 1 cut(s) 142
MboII GAAGA 1 cut(s) 19
MluCI AATT 1 cut(s) 162
MnlI CCTC 6 cut(s) 104, 118, 124, 134, 158, 161
MseI TTAA 1 cut(s) 35
NdeII GATC 1 cut(s) 142
PfeI GAWTC 1 cut(s) 206
PflMI CCANNNNNTGG 1 cut(s) 76
RsaI GTAC 1 cut(s) 106
RsaNI GTAC 1 cut(s) 105
SaqAI TTAA 1 cut(s) 35
Sau3AI GATC 1 cut(s) 142
SetI ASST 5 cut(s) 33, 96, 110, 123, 150
SgeI CNNG 5 cut(s) 52, 88, 107, 131, 170
Sse9I AATT 1 cut(s) 162
SsiI CCGC 2 cut(s) 111, 129
TaiI ACGT 1 cut(s) 123
TasI AATT 1 cut(s) 162
TfiI GAWTC 1 cut(s) 206
Tru1I TTAA 1 cut(s) 35
Tru9I TTAA 1 cut(s) 35
TspDTI ATGAA 1 cut(s) 198
TspGWI ACGGA 1 cut(s) 92
Van91I CCANNNNNTGG 1 cut(s) 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.