pycom08g13330

Aberrant root formation protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
Physical Location & Seq
Forward (+)
12084440 .. 12084679
240 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom08g13330.1

Sequence Viewer

Length: 192 bp
ATGGTGGACAGTCTGGACCAGTCCTTGCCCCTTCTCTCCGTCTCACAACTCATCAACTTCCTCAATTCGACCCTAGACGCCACTCTAACAGACCCAGACAACGAAGACACAAAAGCCAACGTCTCTCGAGCTCTCACGAAAGTCCACAAATTCGTCTCTTCCCCTTCACTGGACCAGGTCCCGTTTCGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

6.93

Weight (kDa)

4.6

Isoelectric Point (pI)

44.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 149
AcyI GRCGYC 1 cut(s) 78
AfiI CCNNNNNNNGG 1 cut(s) 169
AjnI CCWGG 1 cut(s) 174
AluBI AGCT 1 cut(s) 131
AluI AGCT 1 cut(s) 131
Alw21I GWGCWC 1 cut(s) 133
Alw26I GTCTC 3 cut(s) 46, 127, 160
Ama87I CYCGRG 1 cut(s) 126
ApoI RAATTY 1 cut(s) 149
AspS9I GGNCC 3 cut(s) 16, 172, 178
AvaI CYCGRG 1 cut(s) 126
AvaII GGWCC 3 cut(s) 16, 172, 178
BanII GRGCYC 1 cut(s) 133
BbsI GAAGAC 1 cut(s) 111
Bbv12I GWGCWC 1 cut(s) 133
BciT130I CCWGG 1 cut(s) 176
BcoDI GTCTC 3 cut(s) 46, 127, 160
BfaI CTAG 1 cut(s) 74
Bme1390I CCNGG 1 cut(s) 176
Bme18I GGWCC 3 cut(s) 16, 172, 178
BmeT110I CYCGRG 1 cut(s) 126
BmgT120I GGNCC 3 cut(s) 16, 172, 178
BmiI GGNNCC 1 cut(s) 180
BmrFI CCNGG 1 cut(s) 176
BpiI GAAGAC 1 cut(s) 111
BsaHI GRCGYC 1 cut(s) 78
Bsc4I CCNNNNNNNGG 1 cut(s) 169
Bse1I ACTGG 2 cut(s) 19, 174
BseBI CCWGG 1 cut(s) 176
BseLI CCNNNNNNNGG 1 cut(s) 169
BseNI ACTGG 2 cut(s) 19, 174
BsiHKAI GWGCWC 1 cut(s) 133
BsiHKCI CYCGRG 1 cut(s) 126
BslFI GGGAC 1 cut(s) 164
BslI CCNNNNNNNGG 1 cut(s) 169
BsmAI GTCTC 3 cut(s) 46, 127, 160
BsmBI CGTCTC 3 cut(s) 46, 127, 160
BsmFI GGGAC 1 cut(s) 164
BsoBI CYCGRG 1 cut(s) 126
Bsp1286I GDGCHC 1 cut(s) 133
BspLI GGNNCC 1 cut(s) 180
BsrI ACTGG 2 cut(s) 19, 174
BssNI GRCGYC 1 cut(s) 78
Bst2UI CCWGG 1 cut(s) 176
Bst4CI ACNGT 1 cut(s) 11
Bst6I CTCTTC 1 cut(s) 163
BstACI GRCGYC 1 cut(s) 78
BstMAI GTCTC 3 cut(s) 46, 127, 160
BstNI CCWGG 1 cut(s) 176
BstSCI CCNGG 1 cut(s) 174
BstV2I GAAGAC 1 cut(s) 111
BtsIMutI CAGTG 1 cut(s) 167
Cfr13I GGNCC 3 cut(s) 16, 172, 178
CseI GACGC 1 cut(s) 86
CsiI ACCWGGT 1 cut(s) 174
CviJI RGCY 2 cut(s) 116, 131
CviKI_1 RGCY 2 cut(s) 116, 131
Eam1104I CTCTTC 1 cut(s) 163
EarI CTCTTC 1 cut(s) 163
Ecl136II GAGCTC 1 cut(s) 131
Eco24I GRGCYC 1 cut(s) 133
Eco47I GGWCC 3 cut(s) 16, 172, 178
Eco53kI GAGCTC 1 cut(s) 131
Eco88I CYCGRG 1 cut(s) 126
EcoICRI GAGCTC 1 cut(s) 131
EcoO109I RGGNCCY 1 cut(s) 178
EcoRII CCWGG 1 cut(s) 174
EcoT38I GRGCYC 1 cut(s) 133
Esp3I CGTCTC 3 cut(s) 46, 127, 160
FaqI GGGAC 1 cut(s) 164
FriOI GRGCYC 1 cut(s) 133
FspBI CTAG 1 cut(s) 74
HgaI GACGC 1 cut(s) 86
Hin1I GRCGYC 1 cut(s) 78
Hpy166II GTNNAC 2 cut(s) 7, 145
Hpy188III TCNNGA 3 cut(s) 14, 126, 136
Hpy8I GTNNAC 2 cut(s) 7, 145
HpyAV CCTTC 2 cut(s) 41, 174
HpyCH4III ACNGT 1 cut(s) 11
HpyCH4IV ACGT 1 cut(s) 120
HpySE526I ACGT 1 cut(s) 120
Hsp92I GRCGYC 1 cut(s) 78
LpnPI CCDG 5 cut(s) 32, 108, 155, 161, 188
MabI ACCWGGT 1 cut(s) 174
MaeI CTAG 1 cut(s) 74
MaeII ACGT 1 cut(s) 120
MboII GAAGA 2 cut(s) 116, 150
MhlI GDGCHC 1 cut(s) 133
MluCI AATT 2 cut(s) 64, 149
MnlI CCTC 1 cut(s) 71
MseI TTAA 1 cut(s) 190
MspR9I CCNGG 1 cut(s) 176
MvaI CCWGG 1 cut(s) 176
NlaIV GGNNCC 1 cut(s) 180
PaeR7I CTCGAG 1 cut(s) 126
PflFI GACNNNGTC 1 cut(s) 176
PpuMI RGGWCCY 1 cut(s) 178
Psp124BI GAGCTC 1 cut(s) 133
Psp5II RGGWCCY 1 cut(s) 178
Psp6I CCWGG 1 cut(s) 174
PspGI CCWGG 1 cut(s) 174
PspN4I GGNNCC 1 cut(s) 180
PspPI GGNCC 3 cut(s) 16, 172, 178
PspPPI RGGWCCY 1 cut(s) 178
PsyI GACNNNGTC 1 cut(s) 176
SacI GAGCTC 1 cut(s) 133
SaqAI TTAA 1 cut(s) 190
Sau96I GGNCC 3 cut(s) 16, 172, 178
ScrFI CCNGG 1 cut(s) 176
SduI GDGCHC 1 cut(s) 133
SetI ASST 3 cut(s) 123, 133, 180
SexAI ACCWGGT 1 cut(s) 174
Sfr274I CTCGAG 1 cut(s) 126
SinI GGWCC 3 cut(s) 16, 172, 178
SlaI CTCGAG 1 cut(s) 126
SmlI CTYRAG 1 cut(s) 126
SmoI CTYRAG 1 cut(s) 126
Sse9I AATT 2 cut(s) 64, 149
SspMI CTAG 1 cut(s) 74
SstI GAGCTC 1 cut(s) 133
StyD4I CCNGG 1 cut(s) 174
TaaI ACNGT 1 cut(s) 11
TaiI ACGT 1 cut(s) 123
TaqI TCGA 2 cut(s) 68, 127
TasI AATT 2 cut(s) 64, 149
Tru1I TTAA 1 cut(s) 190
Tru9I TTAA 1 cut(s) 190
TscAI CASTG 1 cut(s) 174
TspGWI ACGGA 1 cut(s) 28
TspRI CASTG 1 cut(s) 174
Tth111I GACNNNGTC 1 cut(s) 176
VpaK11BI GGWCC 3 cut(s) 16, 172, 178
XapI RAATTY 1 cut(s) 149
XhoI CTCGAG 1 cut(s) 126
XspI CTAG 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.