pycom08g14110

Sister chromatid cohesion protein PDS5 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
OG0003552
Physical Location & Seq
Reverse (-)
13180472 .. 13181139
668 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom08g14110.1

Sequence Viewer

Length: 375 bp
ATGACCAATCCCTCTGGGGCAGAATCACAAGAAGTTCTCCCTGCCCTTGAAAGTCGACTTCTAGATTTTGGTGATAGAGTGAGAACACAAGCAGTGGTTGTTGCCTGTGATCTTGCCATGTCTAATATGAGATGCTTTCCTCCCAAAATAATATCTCAGACCACTGAAAGACTTCGGGACAAGACGATAACTATTAGAAAGAAAGCTCTACAGAAGTTGATGGAAGTATATCGAGATTATTATAACAAATGCTTTGAAGGTAGCATGACGATAAGTGACCACTTTGAACAGATTCCATGTAAAATATTGATGCTATGCTTTGATAAAGATTGTATGGATTTCAGAAGATCTATTTCCAGCTGTTCCTTCAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

125

Amino Acids

14.29

Weight (kDa)

8.17

Isoelectric Point (pI)

50.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PDS5 PF20168 7 - 115 4.8e-29 Sister chromatid cohesion protein PDS5 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 243
AccI GTMKAC 1 cut(s) 55
AcuI CTGAAG 1 cut(s) 352
AgsI TTSAA 3 cut(s) 50, 257, 287
AluBI AGCT 2 cut(s) 206, 360
AluI AGCT 2 cut(s) 206, 360
Asp700I GAANNNNTTC 2 cut(s) 171, 291
AsuHPI GGTGA 1 cut(s) 83
BccI CCATC 1 cut(s) 214
BfaI CTAG 1 cut(s) 62
BfmI CTRYAG 1 cut(s) 209
BglII AGATCT 1 cut(s) 347
BmsI GCATC 2 cut(s) 122, 300
BseMII CTCAG 1 cut(s) 170
BslFI GGGAC 1 cut(s) 191
BsmFI GGGAC 1 cut(s) 191
Bsp143I GATC 2 cut(s) 109, 347
BspCNI CTCAG 1 cut(s) 169
BssMI GATC 2 cut(s) 109, 347
BstDEI CTNAG 1 cut(s) 156
BstKTI GATC 2 cut(s) 112, 350
BstMBI GATC 2 cut(s) 109, 347
BstSFI CTRYAG 1 cut(s) 209
BstX2I RGATCY 1 cut(s) 347
BstYI RGATCY 1 cut(s) 347
BtsI GCAGTG 1 cut(s) 99
BtsIMutI CAGTG 2 cut(s) 99, 162
CviAII CATG 3 cut(s) 118, 265, 297
CviJI RGCY 2 cut(s) 206, 360
CviKI_1 RGCY 2 cut(s) 206, 360
DdeI CTNAG 1 cut(s) 156
DpnI GATC 2 cut(s) 111, 349
DpnII GATC 2 cut(s) 109, 347
Eco57I CTGAAG 1 cut(s) 352
FaeI CATG 3 cut(s) 121, 268, 300
FaiI YATR 8 cut(s) 119, 128, 229, 243, 266, 298, 316, 335
FaqI GGGAC 1 cut(s) 191
FatI CATG 3 cut(s) 117, 264, 296
FblI GTMKAC 1 cut(s) 55
FspBI CTAG 1 cut(s) 62
Hin1II CATG 3 cut(s) 121, 268, 300
HincII GTYRAC 1 cut(s) 56
HindII GTYRAC 1 cut(s) 56
HinfI GANTC 2 cut(s) 23, 292
HphI GGTGA 1 cut(s) 83
Hpy166II GTNNAC 1 cut(s) 56
Hpy188I TCNGA 2 cut(s) 159, 344
Hpy188III TCNNGA 3 cut(s) 62, 176, 233
Hpy8I GTNNAC 1 cut(s) 56
HpyAV CCTTC 1 cut(s) 251
HpyF3I CTNAG 1 cut(s) 156
Hsp92II CATG 3 cut(s) 121, 268, 300
Kzo9I GATC 2 cut(s) 109, 347
LpnPI CCDG 3 cut(s) 54, 118, 370
LweI GCATC 2 cut(s) 122, 300
MaeI CTAG 1 cut(s) 62
MaeIII GTNAC 1 cut(s) 275
MalI GATC 2 cut(s) 111, 349
MboI GATC 2 cut(s) 109, 347
MboII GAAGA 1 cut(s) 357
MflI RGATCY 1 cut(s) 347
MnlI CCTC 2 cut(s) 22, 150
MroXI GAANNNNTTC 2 cut(s) 171, 291
MspA1I CMGCKG 1 cut(s) 360
NdeII GATC 2 cut(s) 109, 347
NlaIII CATG 3 cut(s) 121, 268, 300
NmuCI GTSAC 1 cut(s) 275
PdmI GAANNNNTTC 2 cut(s) 171, 291
PfeI GAWTC 2 cut(s) 23, 292
PsiI TTATAA 1 cut(s) 243
PsuI RGATCY 1 cut(s) 347
PvuII CAGCTG 1 cut(s) 360
SalI GTCGAC 1 cut(s) 54
Sau3AI GATC 2 cut(s) 109, 347
SetI ASST 3 cut(s) 208, 262, 362
SfaNI GCATC 2 cut(s) 122, 300
SfcI CTRYAG 1 cut(s) 209
SspI AATATT 1 cut(s) 306
SspMI CTAG 1 cut(s) 62
TaqI TCGA 2 cut(s) 55, 232
TfiI GAWTC 2 cut(s) 23, 292
TscAI CASTG 2 cut(s) 99, 169
TseFI GTSAC 1 cut(s) 275
Tsp45I GTSAC 1 cut(s) 275
TspRI CASTG 2 cut(s) 99, 169
XbaI TCTAGA 1 cut(s) 61
XmiI GTMKAC 1 cut(s) 55
XmnI GAANNNNTTC 2 cut(s) 171, 291
XspI CTAG 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.