Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr11

Orthogroup ID

OG0015836

Physical Location & Seq

Genomic Coordinates Forward (+)

2858546 .. 2858749

Gene Structure 204 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 204 bp

ATGTTCAGCTACATCAACCTCTACGGAAACTACCCACCAGGACTATTCGCCAATGAGTGCCACGACGGTAAAGAAGGTCTGATATGCCCTGCATTACCACCATCTGCAGTGGCCAATGATGTAAATGGGGCTCATACCGCACACTATCCGTCTCCATTGCTAATGCTTGTTGCCGACTTCCTAGCATTGTCCCGGTTACTATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0005575 GO:0005623 GO:0005886 GO:0006935 GO:0008150 GO:0008219 GO:0009566 GO:0009567 GO:0009605 GO:0009856 GO:0009987 GO:0010183 GO:0010198 GO:0010483 GO:0010623 GO:0012501 GO:0016020 GO:0019953 GO:0022414 GO:0030154 GO:0031224 GO:0031225 GO:0032501 GO:0032502 GO:0040008 GO:0040011 GO:0042221 GO:0042330 GO:0042995 GO:0044425 GO:0044464 GO:0044703 GO:0044706 GO:0045927 GO:0048468 GO:0048518 GO:0048856 GO:0048868 GO:0048869 GO:0050789 GO:0050896 GO:0050918 GO:0051703 GO:0051704 GO:0065007 GO:0071944 GO:0090406 GO:0120025

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

68

Amino Acids

7.2

Weight (kDa)

5.24

Isoelectric Point (pI)

47.71

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
LLG1	PF26578	1 - 27	2.4e-10	LLG1 domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015836)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G26466 AT5G56170
fragaria_vesca	FvH4_3g41680 FvH4_3g41680
malus_domestica	MD03G1042000.v1.1 MD11G1042800.v1.1
prunus_persica	Prupe.6G033900_v2.0.a1 Prupe.6G033900_v2.0.a1
pyrus_communis	pycom03g03250 pycom11g03680
rosa_chinensis	RchiOBHm_Chr5g0074771
rosa_laevigata	RLG00000036503
rosa_samantha	Rh5AG491500 Rh5DG524900
rosa_wichuraiana	Rw5G045520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	138
AcoI	YGGCCR	1 cut(s)	111
AjnI	CCWGG	1 cut(s)	37
AluBI	AGCT	1 cut(s)	9
AluI	AGCT	1 cut(s)	9
Alw26I	GTCTC	1 cut(s)	156
AoxI	GGCC	1 cut(s)	111
AsuC2I	CCSGG	1 cut(s)	193
BalI	TGGCCA	1 cut(s)	113
BanII	GRGCYC	1 cut(s)	133
BccI	CCATC	1 cut(s)	109
BciT130I	CCWGG	1 cut(s)	39
BcnI	CCSGG	1 cut(s)	193
BcoDI	GTCTC	1 cut(s)	156
BfaI	CTAG	1 cut(s)	182
BfmI	CTRYAG	1 cut(s)	105
Bme1390I	CCNGG	2 cut(s)	39, 193
BmrFI	CCNGG	2 cut(s)	39, 193
BpuMI	CCSGG	1 cut(s)	193
Bse3DI	GCAATG	1 cut(s)	155
BseBI	CCWGG	1 cut(s)	39
BseMI	GCAATG	1 cut(s)	155
BshFI	GGCC	1 cut(s)	113
BsiSI	CCGG	1 cut(s)	193
BslFI	GGGAC	1 cut(s)	175
BsmAI	GTCTC	1 cut(s)	156
BsmBI	CGTCTC	1 cut(s)	156
BsmFI	GGGAC	1 cut(s)	175
BsnI	GGCC	1 cut(s)	113
Bsp1286I	GDGCHC	1 cut(s)	133
BspACI	CCGC	1 cut(s)	138
BspANI	GGCC	1 cut(s)	113
BspMAI	CTGCAG	1 cut(s)	109
BsrDI	GCAATG	1 cut(s)	155
Bst2UI	CCWGG	1 cut(s)	39
Bst4CI	ACNGT	1 cut(s)	68
BstMAI	GTCTC	1 cut(s)	156
BstMWI	GCNNNNNNNGC	1 cut(s)	137
BstNI	CCWGG	1 cut(s)	39
BstSCI	CCNGG	2 cut(s)	37, 191
BstSFI	CTRYAG	1 cut(s)	105
BsuRI	GGCC	1 cut(s)	113
BtsI	GCAGTG	1 cut(s)	114
BtsIMutI	CAGTG	1 cut(s)	114
CviJI	RGCY	3 cut(s)	9, 113, 131
CviKI_1	RGCY	3 cut(s)	9, 113, 131
EaeI	YGGCCR	1 cut(s)	111
Eco24I	GRGCYC	1 cut(s)	133
EcoRII	CCWGG	1 cut(s)	37
EcoT38I	GRGCYC	1 cut(s)	133
Esp3I	CGTCTC	1 cut(s)	156
FaiI	YATR	3 cut(s)	85, 135, 202
FaqI	GGGAC	1 cut(s)	175
FriOI	GRGCYC	1 cut(s)	133
FspBI	CTAG	1 cut(s)	182
HaeIII	GGCC	1 cut(s)	113
HapII	CCGG	1 cut(s)	193
HpaII	CCGG	1 cut(s)	193
Hpy188I	TCNGA	1 cut(s)	81
Hpy99I	CGWCG	1 cut(s)	68
HpyAV	CCTTC	1 cut(s)	68
HpyCH4III	ACNGT	1 cut(s)	68
HpyCH4V	TGCA	2 cut(s)	92, 107
HpyF10VI	GCNNNNNNNGC	1 cut(s)	137
LpnPI	CCDG	3 cut(s)	24, 51, 102
MaeI	CTAG	1 cut(s)	182
MaeIII	GTNAC	1 cut(s)	195
MhlI	GDGCHC	1 cut(s)	133
MlsI	TGGCCA	1 cut(s)	113
MluNI	TGGCCA	1 cut(s)	113
MnlI	CCTC	1 cut(s)	29
Mox20I	TGGCCA	1 cut(s)	113
MscI	TGGCCA	1 cut(s)	113
Msp20I	TGGCCA	1 cut(s)	113
MspI	CCGG	1 cut(s)	193
MspR9I	CCNGG	2 cut(s)	39, 193
MvaI	CCWGG	1 cut(s)	39
MwoI	GCNNNNNNNGC	1 cut(s)	137
NciI	CCSGG	1 cut(s)	193
Psp6I	CCWGG	1 cut(s)	37
PspGI	CCWGG	1 cut(s)	37
PstI	CTGCAG	1 cut(s)	109
ScrFI	CCNGG	2 cut(s)	39, 193
SduI	GDGCHC	1 cut(s)	133
SetI	ASST	3 cut(s)	11, 21, 79
SfcI	CTRYAG	1 cut(s)	105
SgeI	CNNG	6 cut(s)	50, 51, 74, 101, 179, 194
SsiI	CCGC	1 cut(s)	138
SspMI	CTAG	1 cut(s)	182
StyD4I	CCNGG	2 cut(s)	37, 191
TaaI	ACNGT	1 cut(s)	68
TscAI	CASTG	1 cut(s)	114
TspGWI	ACGGA	2 cut(s)	39, 138
TspRI	CASTG	1 cut(s)	114
XspI	CTAG	1 cut(s)	182

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.