pycom11g09600

Catalyzes the third of the four reactions of the long- chain fatty acids elongation cycle. This endoplasmic reticulum- bound enzymatic process, allows the addition of two carbons to the chain of long- and very long-chain fatty acids VLCFAs per cycle. This enzyme catalyzes the dehydration of the 3-hydroxyacyl-CoA intermediate into trans-2,3-enoyl-CoA, within each cycle of fatty acid elongation. Thereby, it participates to the production of VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
OG0010281
Physical Location & Seq
Forward (+)
7861854 .. 7863505
1652 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 348 bp
ATGCAATGGGCAGGAAGGGCCGATTTTTTGTATGTTGTGCGCCAAACCCATGAGGTCCAAGAGTCACCATCAGTCTTCATAACTTTTGTTGCTTGGAGCTTAACTGAGGTTATTAGGTATCCACATTATGCTTTTAATTGCACGGGTAGCTGTCCATCTTGGATTACCTATCTCAGGTACACTGCATTCATTGTCTTGTATCCTCCAGGGATGGCTGGTGAAACCTGGCTTACATACCAAGCACTTCCTTTTATAAACAAGAAGAGCCTCTCCCCACATTTCTCCGCTGGCCTCTCTTTCAGCTATTATCACTTTCTGAGGGTATGTTCTGTTTTTTTTCCACCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00062 ko01040 ko01110 ko01212 map00062 map01040 map01110 map01212
Pfam Domains
Protein Families
PTPLA

Protein Analysis

116

Amino Acids

13.35

Weight (kDa)

8.49

Isoelectric Point (pI)

51.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PTPLA PF04387 1 - 115 7.7e-34 Protein tyrosine phosphatase-like protein, PTPLA
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 254
AciI CCGC 1 cut(s) 285
AfaI GTAC 1 cut(s) 179
AfiI CCNNNNNNNGG 1 cut(s) 174
AjnI CCWGG 2 cut(s) 205, 224
AluBI AGCT 3 cut(s) 99, 150, 303
AluI AGCT 3 cut(s) 99, 150, 303
AoxI GGCC 2 cut(s) 18, 289
AspLEI GCGC 1 cut(s) 42
AspS9I GGNCC 2 cut(s) 18, 55
AsuHPI GGTGA 2 cut(s) 57, 230
AvaII GGWCC 1 cut(s) 55
BbsI GAAGAC 1 cut(s) 67
BccI CCATC 3 cut(s) 76, 163, 205
BciT130I CCWGG 2 cut(s) 207, 226
BciVI GTATCC 2 cut(s) 129, 210
BfuI GTATCC 2 cut(s) 129, 210
Bme1390I CCNGG 2 cut(s) 207, 226
Bme18I GGWCC 1 cut(s) 55
BmgT120I GGNCC 2 cut(s) 18, 55
BmrFI CCNGG 2 cut(s) 207, 226
BpiI GAAGAC 1 cut(s) 67
BpmI CTGGAG 1 cut(s) 189
BsaJI CCNNGG 1 cut(s) 206
Bsc4I CCNNNNNNNGG 1 cut(s) 174
Bse3DI GCAATG 1 cut(s) 11
BseBI CCWGG 2 cut(s) 207, 226
BseDI CCNNGG 1 cut(s) 206
BseGI GGATG 1 cut(s) 216
BseLI CCNNNNNNNGG 1 cut(s) 174
BseMI GCAATG 1 cut(s) 11
BseMII CTCAG 3 cut(s) 96, 187, 308
BshFI GGCC 2 cut(s) 20, 291
BslI CCNNNNNNNGG 1 cut(s) 174
BsmI GAATGC 1 cut(s) 185
BsnI GGCC 2 cut(s) 20, 291
BspACI CCGC 1 cut(s) 285
BspANI GGCC 2 cut(s) 20, 291
BspCNI CTCAG 3 cut(s) 97, 186, 309
BspQI GCTCTTC 1 cut(s) 257
BsrDI GCAATG 1 cut(s) 11
BssECI CCNNGG 1 cut(s) 206
Bst2UI CCWGG 2 cut(s) 207, 226
Bst6I CTCTTC 1 cut(s) 257
BstC8I GCNNGC 1 cut(s) 289
BstDEI CTNAG 3 cut(s) 105, 173, 317
BstENI CCTNNNNNAGG 1 cut(s) 172
BstF5I GGATG 1 cut(s) 216
BstHHI GCGC 1 cut(s) 42
BstMWI GCNNNNNNNGC 2 cut(s) 17, 147
BstNI CCWGG 2 cut(s) 207, 226
BstSCI CCNGG 2 cut(s) 205, 224
BstV2I GAAGAC 1 cut(s) 67
BsuI GTATCC 2 cut(s) 129, 210
BsuRI GGCC 2 cut(s) 20, 291
BtsCI GGATG 1 cut(s) 216
BtsI GCAGTG 1 cut(s) 180
BtsIMutI CAGTG 1 cut(s) 180
Cac8I GCNNGC 1 cut(s) 289
CfoI GCGC 1 cut(s) 42
Cfr13I GGNCC 2 cut(s) 18, 55
Csp6I GTAC 1 cut(s) 178
CviAII CATG 2 cut(s) 50, 345
CviJI RGCY 8 cut(s) 20, 99, 150, 215, 229, 267, 291, 303
CviKI_1 RGCY 8 cut(s) 20, 99, 150, 215, 229, 267, 291, 303
CviQI GTAC 1 cut(s) 178
DdeI CTNAG 3 cut(s) 105, 173, 317
Eam1104I CTCTTC 1 cut(s) 257
EarI CTCTTC 1 cut(s) 257
Eco47I GGWCC 1 cut(s) 55
EcoNI CCTNNNNNAGG 1 cut(s) 172
EcoRII CCWGG 2 cut(s) 205, 224
FaeI CATG 2 cut(s) 53, 348
FaiI YATR 8 cut(s) 33, 51, 80, 129, 235, 254, 325, 346
FatI CATG 2 cut(s) 49, 344
FokI GGATG 1 cut(s) 223
GlaI GCGC 1 cut(s) 41
GsuI CTGGAG 1 cut(s) 189
HaeIII GGCC 2 cut(s) 20, 291
HhaI GCGC 1 cut(s) 42
Hin1II CATG 2 cut(s) 53, 348
Hin6I GCGC 1 cut(s) 40
HinP1I GCGC 1 cut(s) 40
HinfI GANTC 1 cut(s) 62
HphI GGTGA 2 cut(s) 57, 230
Hpy166II GTNNAC 1 cut(s) 180
Hpy188I TCNGA 1 cut(s) 318
Hpy8I GTNNAC 1 cut(s) 180
HpyAV CCTTC 1 cut(s) 9
HpyCH4V TGCA 3 cut(s) 4, 141, 185
HpyF10VI GCNNNNNNNGC 2 cut(s) 17, 147
HpyF3I CTNAG 3 cut(s) 105, 173, 317
Hsp92II CATG 2 cut(s) 53, 348
HspAI GCGC 1 cut(s) 40
LguI GCTCTTC 1 cut(s) 257
LmnI GCTCC 1 cut(s) 96
LpnPI CCDG 7 cut(s) 160, 192, 201, 211, 219, 238, 273
MaeIII GTNAC 1 cut(s) 63
MboII GAAGA 2 cut(s) 67, 274
MluCI AATT 1 cut(s) 136
MlyI GAGTC 1 cut(s) 71
MnlI CCTC 6 cut(s) 46, 100, 213, 278, 302, 312
MseI TTAA 2 cut(s) 101, 135
MspA1I CMGCKG 1 cut(s) 287
MspR9I CCNGG 2 cut(s) 207, 226
Mva1269I GAATGC 1 cut(s) 185
MvaI CCWGG 2 cut(s) 207, 226
MwoI GCNNNNNNNGC 2 cut(s) 17, 147
NlaIII CATG 2 cut(s) 53, 348
NmuCI GTSAC 1 cut(s) 63
PciSI GCTCTTC 1 cut(s) 257
PctI GAATGC 1 cut(s) 185
PleI GAGTC 1 cut(s) 70
PpsI GAGTC 1 cut(s) 70
PsiI TTATAA 1 cut(s) 254
Psp6I CCWGG 2 cut(s) 205, 224
PspGI CCWGG 2 cut(s) 205, 224
PspPI GGNCC 2 cut(s) 18, 55
RsaI GTAC 1 cut(s) 179
RsaNI GTAC 1 cut(s) 178
SapI GCTCTTC 1 cut(s) 257
SaqAI TTAA 2 cut(s) 101, 135
Sau96I GGNCC 2 cut(s) 18, 55
SchI GAGTC 1 cut(s) 71
ScrFI CCNGG 2 cut(s) 207, 226
SetI ASST 9 cut(s) 57, 101, 111, 119, 152, 170, 179, 227, 305
SinI GGWCC 1 cut(s) 55
Sse9I AATT 1 cut(s) 136
SsiI CCGC 1 cut(s) 285
StyD4I CCNGG 2 cut(s) 205, 224
TasI AATT 1 cut(s) 136
Tru1I TTAA 2 cut(s) 101, 135
Tru9I TTAA 2 cut(s) 101, 135
TscAI CASTG 1 cut(s) 187
TseFI GTSAC 1 cut(s) 63
Tsp45I GTSAC 1 cut(s) 63
TspDTI ATGAA 2 cut(s) 67, 178
TspRI CASTG 1 cut(s) 187
VpaK11BI GGWCC 1 cut(s) 55
XagI CCTNNNNNAGG 1 cut(s) 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.