Rmu_sc0026275.1_g000001

Catalyzes the third of the four reactions of the long- chain fatty acids elongation cycle. This endoplasmic reticulum- bound enzymatic process, allows the addition of two carbons to the chain of long- and very long-chain fatty acids VLCFAs per cycle. This enzyme catalyzes the dehydration of the 3-hydroxyacyl-CoA intermediate into trans-2,3-enoyl-CoA, within each cycle of fatty acid elongation. Thereby, it participates to the production of VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0026275.1
Physical Location & Seq
Reverse (-)
1 .. 2449
2449 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0026275.1_g000001.1.cds

Sequence Viewer

Length: 237 bp
gtccaacagttgccagcagtctttataacttttgttgcatggagcatcagtgaggttattagatatccaaattatgctttgaattgcatcggaagttgtccgccttggcttacttatctcaggtactctgcattccttgtcttgtatcctcctgggatgggtggtgaaacctggattatgtaccatgcactgccatttttgaagaagtactccttcagctattatacttttctgatg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

9.25

Weight (kDa)

8.64

Isoelectric Point (pI)

49.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 26
AciI CCGC 1 cut(s) 101
AcuI CTGAAG 1 cut(s) 199
AfaI GTAC 3 cut(s) 125, 182, 209
AfiI CCNNNNNNNGG 1 cut(s) 158
AgsI TTSAA 2 cut(s) 82, 202
AjnI CCWGG 2 cut(s) 151, 170
AluBI AGCT 1 cut(s) 219
AluI AGCT 1 cut(s) 219
AsuHPI GGTGA 1 cut(s) 176
BccI CCATC 1 cut(s) 151
BciT130I CCWGG 2 cut(s) 153, 172
BciVI GTATCC 1 cut(s) 156
BfuI GTATCC 1 cut(s) 156
BmcAI AGTACT 1 cut(s) 209
Bme1390I CCNGG 2 cut(s) 153, 172
BmrFI CCNGG 2 cut(s) 153, 172
BmsI GCATC 2 cut(s) 54, 96
BsaJI CCNNGG 2 cut(s) 104, 152
BsaXI ACNNNNNCTCC 2 cut(s) 34, 64
Bsc4I CCNNNNNNNGG 1 cut(s) 158
BseBI CCWGG 2 cut(s) 153, 172
BseDI CCNNGG 2 cut(s) 104, 152
BseGI GGATG 1 cut(s) 162
BseLI CCNNNNNNNGG 1 cut(s) 158
BseMII CTCAG 1 cut(s) 133
BslI CCNNNNNNNGG 1 cut(s) 158
BsmI GAATGC 1 cut(s) 131
BspACI CCGC 1 cut(s) 101
BspCNI CTCAG 1 cut(s) 132
BssECI CCNNGG 2 cut(s) 104, 152
BssT1I CCWWGG 1 cut(s) 104
Bst2UI CCWGG 2 cut(s) 153, 172
Bst4CI ACNGT 1 cut(s) 9
BstC8I GCNNGC 1 cut(s) 15
BstDEI CTNAG 1 cut(s) 119
BstF5I GGATG 1 cut(s) 162
BstNI CCWGG 2 cut(s) 153, 172
BstSCI CCNGG 2 cut(s) 151, 170
BsuI GTATCC 1 cut(s) 156
BtsCI GGATG 1 cut(s) 162
BtsI GCAGTG 1 cut(s) 188
BtsIMutI CAGTG 2 cut(s) 55, 188
Cac8I GCNNGC 1 cut(s) 15
Csp6I GTAC 3 cut(s) 124, 181, 208
CviAII CATG 2 cut(s) 39, 185
CviJI RGCY 2 cut(s) 109, 219
CviKI_1 RGCY 2 cut(s) 109, 219
CviQI GTAC 3 cut(s) 124, 181, 208
DdeI CTNAG 1 cut(s) 119
EciI GGCGGA 1 cut(s) 90
Eco130I CCWWGG 1 cut(s) 104
Eco32I GATATC 1 cut(s) 65
Eco57I CTGAAG 1 cut(s) 199
EcoRII CCWGG 2 cut(s) 151, 170
EcoRV GATATC 1 cut(s) 65
EcoT14I CCWWGG 1 cut(s) 104
ErhI CCWWGG 1 cut(s) 104
FaeI CATG 2 cut(s) 42, 188
FaiI YATR 6 cut(s) 26, 40, 75, 179, 186, 225
FalI AAGNNNNNCTT 2 cut(s) 197, 229
FatI CATG 2 cut(s) 38, 184
FokI GGATG 1 cut(s) 169
Hin1II CATG 2 cut(s) 42, 188
HphI GGTGA 1 cut(s) 176
Hpy188I TCNGA 2 cut(s) 92, 234
HpyAV CCTTC 1 cut(s) 223
HpyCH4III ACNGT 1 cut(s) 9
HpyCH4V TGCA 4 cut(s) 38, 87, 131, 188
HpyF3I CTNAG 1 cut(s) 119
Hsp92II CATG 2 cut(s) 42, 188
LmnI GCTCC 1 cut(s) 42
LpnPI CCDG 6 cut(s) 27, 106, 138, 157, 165, 184
LweI GCATC 2 cut(s) 54, 96
MboII GAAGA 1 cut(s) 214
MluCI AATT 2 cut(s) 70, 82
MmeI TCCRAC 1 cut(s) 28
MnlI CCTC 2 cut(s) 46, 159
MspR9I CCNGG 2 cut(s) 153, 172
Mva1269I GAATGC 1 cut(s) 131
MvaI CCWGG 2 cut(s) 153, 172
NlaIII CATG 2 cut(s) 42, 188
PctI GAATGC 1 cut(s) 131
PsiI TTATAA 1 cut(s) 26
Psp6I CCWGG 2 cut(s) 151, 170
PspGI CCWGG 2 cut(s) 151, 170
RsaI GTAC 3 cut(s) 125, 182, 209
RsaNI GTAC 3 cut(s) 124, 181, 208
ScaI AGTACT 1 cut(s) 209
ScrFI CCNGG 2 cut(s) 153, 172
SetI ASST 4 cut(s) 57, 125, 173, 221
SfaNI GCATC 2 cut(s) 54, 96
Sse9I AATT 2 cut(s) 70, 82
SsiI CCGC 1 cut(s) 101
StyD4I CCNGG 2 cut(s) 151, 170
StyI CCWWGG 1 cut(s) 104
TaaI ACNGT 1 cut(s) 9
TasI AATT 2 cut(s) 70, 82
TatI WGTACW 1 cut(s) 207
TscAI CASTG 2 cut(s) 55, 195
TspRI CASTG 2 cut(s) 55, 195
ZrmI AGTACT 1 cut(s) 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.