Rh5DG440800

Catalyzes the third of the four reactions of the long- chain fatty acids elongation cycle. This endoplasmic reticulum- bound enzymatic process, allows the addition of two carbons to the chain of long- and very long-chain fatty acids VLCFAs per cycle. This enzyme catalyzes the dehydration of the 3-hydroxyacyl-CoA intermediate into trans-2,3-enoyl-CoA, within each cycle of fatty acid elongation. Thereby, it participates to the production of VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0010281
Physical Location & Seq
Reverse (-)
70646420 .. 70650373
3954 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG440800.1

Sequence Viewer

Length: 342 bp
ATGCCTTCTCTATCCAACACCTATCTCTTGGCCTACAACTCTGCTCAGGCCATTGCATGGGCAGTTTGTCTCTCTCTAAGCTTGAGCAGTGTGCTGTCCACCAAGGGGGTCAATGGAGCCTATGCTTCTGCTGGAAACCTCATCTATTTGTGCCAGATGGTTGCGTTCTTGGAAGTCATACACGGAGCCATTGGTCTGGTGCCGAGTGGAGTGGTGATTCCTCTGATGCAATGGGCAGGGAGGACAAACTGTATTTTTGTAATGCGTCAAACCCATGAGGTCCAACAGTTGCCAGCAGTCTTTGTAACTTTTGTTGCATGGAGCATCAGTGAGGTGATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00062 ko01040 ko01110 ko01212 map00062 map01040 map01110 map01212
Pfam Domains
Protein Families
PTPLA

Protein Analysis

113

Amino Acids

12.12

Weight (kDa)

6.69

Isoelectric Point (pI)

21.87

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PTPLA PF04387 52 - 113 1.2e-15 Protein tyrosine phosphatase-like protein, PTPLA
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 199
AccB7I CCANNNNNTGG 1 cut(s) 57
AfiI CCNNNNNNNGG 2 cut(s) 57, 105
AluBI AGCT 1 cut(s) 81
AluI AGCT 1 cut(s) 81
Alw26I GTCTC 1 cut(s) 74
AoxI GGCC 2 cut(s) 30, 48
AspS9I GGNCC 1 cut(s) 280
AsuHPI GGTGA 1 cut(s) 226
AvaII GGWCC 1 cut(s) 280
BanI GGYRCC 1 cut(s) 199
BccI CCATC 1 cut(s) 151
BcoDI GTCTC 1 cut(s) 74
Bme18I GGWCC 1 cut(s) 280
BmgT120I GGNCC 1 cut(s) 280
BmiI GGNNCC 3 cut(s) 118, 187, 201
BmsI GCATC 2 cut(s) 216, 333
Bpu10I CCTNAGC 1 cut(s) 45
BpuEI CTTGAG 1 cut(s) 103
BsaJI CCNNGG 1 cut(s) 102
BsaXI ACNNNNNCTCC 1 cut(s) 313
Bsc4I CCNNNNNNNGG 2 cut(s) 57, 105
Bse3DI GCAATG 2 cut(s) 51, 236
BseDI CCNNGG 1 cut(s) 102
BseLI CCNNNNNNNGG 2 cut(s) 57, 105
BseMI GCAATG 2 cut(s) 51, 236
BseMII CTCAG 1 cut(s) 59
BshFI GGCC 2 cut(s) 32, 50
BshNI GGYRCC 1 cut(s) 199
BslI CCNNNNNNNGG 2 cut(s) 57, 105
BsmAI GTCTC 1 cut(s) 74
BsnI GGCC 2 cut(s) 32, 50
BspANI GGCC 2 cut(s) 32, 50
BspCNI CTCAG 1 cut(s) 58
BspLI GGNNCC 3 cut(s) 118, 187, 201
BspT107I GGYRCC 1 cut(s) 199
BsrDI GCAATG 2 cut(s) 51, 236
BssECI CCNNGG 1 cut(s) 102
BssT1I CCWWGG 1 cut(s) 102
Bst4CI ACNGT 2 cut(s) 251, 288
BstC8I GCNNGC 1 cut(s) 294
BstDEI CTNAG 2 cut(s) 45, 77
BstMAI GTCTC 1 cut(s) 74
BstXI CCANNNNNNTGG 1 cut(s) 196
BsuRI GGCC 2 cut(s) 32, 50
BtsI GCAGTG 1 cut(s) 94
BtsIMutI CAGTG 2 cut(s) 94, 334
Cac8I GCNNGC 1 cut(s) 294
Cfr13I GGNCC 1 cut(s) 280
CseI GACGC 1 cut(s) 254
CviAII CATG 3 cut(s) 57, 275, 318
CviJI RGCY 5 cut(s) 32, 50, 81, 119, 188
CviKI_1 RGCY 5 cut(s) 32, 50, 81, 119, 188
DdeI CTNAG 2 cut(s) 45, 77
Eco130I CCWWGG 1 cut(s) 102
Eco47I GGWCC 1 cut(s) 280
EcoT14I CCWWGG 1 cut(s) 102
ErhI CCWWGG 1 cut(s) 102
FaeI CATG 3 cut(s) 60, 278, 321
FaiI YATR 5 cut(s) 58, 123, 179, 276, 319
FatI CATG 3 cut(s) 56, 274, 317
HaeIII GGCC 2 cut(s) 32, 50
HgaI GACGC 1 cut(s) 254
Hin1II CATG 3 cut(s) 60, 278, 321
HindIII AAGCTT 1 cut(s) 79
HinfI GANTC 1 cut(s) 217
HphI GGTGA 1 cut(s) 226
Hpy166II GTNNAC 1 cut(s) 99
Hpy188I TCNGA 1 cut(s) 225
Hpy8I GTNNAC 1 cut(s) 99
HpyAV CCTTC 1 cut(s) 15
HpyCH4III ACNGT 2 cut(s) 251, 288
HpyCH4V TGCA 3 cut(s) 56, 229, 317
HpyF3I CTNAG 2 cut(s) 45, 77
Hsp92II CATG 3 cut(s) 60, 278, 321
LmnI GCTCC 3 cut(s) 116, 185, 321
LpnPI CCDG 6 cut(s) 32, 117, 167, 182, 222, 306
LweI GCATC 2 cut(s) 216, 333
MaeIII GTNAC 1 cut(s) 304
MmeI TCCRAC 2 cut(s) 39, 307
MnlI CCTC 5 cut(s) 149, 231, 234, 271, 325
NlaIII CATG 3 cut(s) 60, 278, 321
NlaIV GGNNCC 3 cut(s) 118, 187, 201
NmeAIII GCCGAG 1 cut(s) 228
PfeI GAWTC 1 cut(s) 217
PflMI CCANNNNNTGG 1 cut(s) 57
PspN4I GGNNCC 3 cut(s) 118, 187, 201
PspPI GGNCC 1 cut(s) 280
Sau96I GGNCC 1 cut(s) 280
SetI ASST 5 cut(s) 23, 83, 141, 282, 336
SfaNI GCATC 2 cut(s) 216, 333
SinI GGWCC 1 cut(s) 280
SmlI CTYRAG 1 cut(s) 82
SmoI CTYRAG 1 cut(s) 82
StyI CCWWGG 1 cut(s) 102
TaaI ACNGT 2 cut(s) 251, 288
TfiI GAWTC 1 cut(s) 217
TscAI CASTG 2 cut(s) 94, 334
TspGWI ACGGA 1 cut(s) 198
TspRI CASTG 2 cut(s) 94, 334
Van91I CCANNNNNTGG 1 cut(s) 57
VpaK11BI GGWCC 1 cut(s) 280
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.