Rw5G038810

Catalyzes the third of the four reactions of the long- chain fatty acids elongation cycle. This endoplasmic reticulum- bound enzymatic process, allows the addition of two carbons to the chain of long- and very long-chain fatty acids VLCFAs per cycle. This enzyme catalyzes the dehydration of the 3-hydroxyacyl-CoA intermediate into trans-2,3-enoyl-CoA, within each cycle of fatty acid elongation. Thereby, it participates to the production of VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
OG0010281
Physical Location & Seq
Reverse (-)
68600069 .. 68603150
3082 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G038810.1

Sequence Viewer

Length: 624 bp
ATGCCTTCTTTATCCAACATCTATCTCTTGGCCTACAACTCTGCTCAGGCCATTGCATGGGCAGTTTGTCTCTCTCTAAGCTTGAGCAGTGTGCTGTCCACCAAGGGGGTCAATGGAGCCTATGCTTCTGCTGGAAACCTCATCTATTTGTGCCAGATGGTTGCGTTCTTGGAAGTTATACACGGAGCCATTGGTCTGGTGCCGAGTGGAGTGGTGATTCCTCTGATGCAATGGGCAGGGAGGACAAACTGTATTTTTGTAATGCGTCAAACCCATGAGGTCCAACAGTTGCCAGCAGTCTTTATAACTTTTGTTGCATGGAGCATCAGTGAGGTTATTAGATATCCAAACTACGCTTTGAATTGCATCGGAAGTTGTCCGCCTTGGCTTACTTATCTCAGGTACTCTGCATTCCTTGTCTTGTATCCTCCTGGGATGGGTGGTGAAACCTGGATTATGTACTATGCACTTCCATTTTTGAAGAAGTACTCCTTCAGCTATTATACTTTTCTGATGGTTGTGCTTTTCTGCTACCCTATCCTGTGTTTGAAAGTGTACCTGCACATGGTCAAGCAACGGCGATCAAAGCTGGGTAAACAAGACAAGAAGAAGAAGAAGAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00062 ko01040 ko01110 ko01212 map00062 map01040 map01110 map01212
Pfam Domains
Protein Families
PTPLA

Protein Analysis

207

Amino Acids

23.43

Weight (kDa)

9.56

Isoelectric Point (pI)

40.85

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PTPLA PF04387 52 - 199 3.3e-48 Protein tyrosine phosphatase-like protein, PTPLA
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 305
Acc36I ACCTGC 1 cut(s) 567
AccB1I GGYRCC 1 cut(s) 199
AccB7I CCANNNNNTGG 1 cut(s) 57
AciI CCGC 1 cut(s) 380
AcuI CTGAAG 1 cut(s) 478
AfaI GTAC 4 cut(s) 404, 461, 488, 557
AfiI CCNNNNNNNGG 4 cut(s) 57, 105, 437, 565
AgsI TTSAA 3 cut(s) 361, 481, 550
AjnI CCWGG 2 cut(s) 430, 449
AluBI AGCT 3 cut(s) 81, 498, 589
AluI AGCT 3 cut(s) 81, 498, 589
Alw26I GTCTC 1 cut(s) 74
AoxI GGCC 2 cut(s) 30, 48
AspS9I GGNCC 1 cut(s) 280
AsuHPI GGTGA 2 cut(s) 226, 455
AvaII GGWCC 1 cut(s) 280
BanI GGYRCC 1 cut(s) 199
BccI CCATC 3 cut(s) 151, 430, 508
BceAI ACGGC 1 cut(s) 593
BciT130I CCWGG 2 cut(s) 432, 451
BciVI GTATCC 1 cut(s) 435
BcoDI GTCTC 1 cut(s) 74
BfuAI ACCTGC 1 cut(s) 567
BfuI GTATCC 1 cut(s) 435
BmcAI AGTACT 1 cut(s) 488
Bme1390I CCNGG 2 cut(s) 432, 451
Bme18I GGWCC 1 cut(s) 280
BmgT120I GGNCC 1 cut(s) 280
BmiI GGNNCC 3 cut(s) 118, 187, 201
BmrFI CCNGG 2 cut(s) 432, 451
BmsI GCATC 3 cut(s) 216, 333, 375
Bpu10I CCTNAGC 1 cut(s) 45
BpuEI CTTGAG 1 cut(s) 103
BsaJI CCNNGG 3 cut(s) 102, 383, 431
BsaXI ACNNNNNCTCC 2 cut(s) 313, 343
Bsc4I CCNNNNNNNGG 4 cut(s) 57, 105, 437, 565
Bse3DI GCAATG 2 cut(s) 51, 236
BseBI CCWGG 2 cut(s) 432, 451
BseDI CCNNGG 3 cut(s) 102, 383, 431
BseGI GGATG 1 cut(s) 441
BseLI CCNNNNNNNGG 4 cut(s) 57, 105, 437, 565
BseMI GCAATG 2 cut(s) 51, 236
BseMII CTCAG 2 cut(s) 59, 412
BseYI CCCAGC 1 cut(s) 589
BsgI GTGCAG 1 cut(s) 545
BshFI GGCC 2 cut(s) 32, 50
BshNI GGYRCC 1 cut(s) 199
BslI CCNNNNNNNGG 4 cut(s) 57, 105, 437, 565
BsmAI GTCTC 1 cut(s) 74
BsmI GAATGC 1 cut(s) 410
BsnI GGCC 2 cut(s) 32, 50
Bsp143I GATC 1 cut(s) 581
BspACI CCGC 1 cut(s) 380
BspANI GGCC 2 cut(s) 32, 50
BspCNI CTCAG 2 cut(s) 58, 411
BspLI GGNNCC 3 cut(s) 118, 187, 201
BspMI ACCTGC 1 cut(s) 567
BspT107I GGYRCC 1 cut(s) 199
BsrDI GCAATG 2 cut(s) 51, 236
BssECI CCNNGG 3 cut(s) 102, 383, 431
BssMI GATC 1 cut(s) 581
BssT1I CCWWGG 2 cut(s) 102, 383
Bst2UI CCWGG 2 cut(s) 432, 451
Bst4CI ACNGT 2 cut(s) 251, 288
Bst6I CTCTTC 1 cut(s) 611
BstC8I GCNNGC 1 cut(s) 294
BstDEI CTNAG 3 cut(s) 45, 77, 398
BstF5I GGATG 1 cut(s) 441
BstKTI GATC 1 cut(s) 584
BstMAI GTCTC 1 cut(s) 74
BstMBI GATC 1 cut(s) 581
BstMWI GCNNNNNNNGC 1 cut(s) 586
BstNI CCWGG 2 cut(s) 432, 451
BstSCI CCNGG 2 cut(s) 430, 449
BstXI CCANNNNNNTGG 1 cut(s) 196
BsuI GTATCC 1 cut(s) 435
BsuRI GGCC 2 cut(s) 32, 50
BtsCI GGATG 1 cut(s) 441
BtsI GCAGTG 1 cut(s) 94
BtsIMutI CAGTG 2 cut(s) 94, 334
BveI ACCTGC 1 cut(s) 567
Cac8I GCNNGC 1 cut(s) 294
Cfr13I GGNCC 1 cut(s) 280
CseI GACGC 1 cut(s) 254
Csp6I GTAC 4 cut(s) 403, 460, 487, 556
CviAII CATG 4 cut(s) 57, 275, 318, 565
CviJI RGCY 8 cut(s) 32, 50, 81, 119, 188, 388, 498, 589
CviKI_1 RGCY 8 cut(s) 32, 50, 81, 119, 188, 388, 498, 589
CviQI GTAC 4 cut(s) 403, 460, 487, 556
DdeI CTNAG 3 cut(s) 45, 77, 398
DpnI GATC 1 cut(s) 583
DpnII GATC 1 cut(s) 581
Eam1104I CTCTTC 1 cut(s) 611
EarI CTCTTC 1 cut(s) 611
EciI GGCGGA 1 cut(s) 369
Eco130I CCWWGG 2 cut(s) 102, 383
Eco32I GATATC 1 cut(s) 344
Eco47I GGWCC 1 cut(s) 280
Eco57I CTGAAG 1 cut(s) 478
EcoRII CCWGG 2 cut(s) 430, 449
EcoRV GATATC 1 cut(s) 344
EcoT14I CCWWGG 2 cut(s) 102, 383
ErhI CCWWGG 2 cut(s) 102, 383
FaeI CATG 4 cut(s) 60, 278, 321, 568
FalI AAGNNNNNCTT 2 cut(s) 476, 508
FatI CATG 4 cut(s) 56, 274, 317, 564
FokI GGATG 1 cut(s) 448
GsaI CCCAGC 1 cut(s) 593
HaeIII GGCC 2 cut(s) 32, 50
HgaI GACGC 1 cut(s) 254
Hin1II CATG 4 cut(s) 60, 278, 321, 568
HindIII AAGCTT 1 cut(s) 79
HinfI GANTC 1 cut(s) 217
HphI GGTGA 2 cut(s) 226, 455
Hpy166II GTNNAC 3 cut(s) 99, 556, 596
Hpy188I TCNGA 3 cut(s) 225, 371, 513
Hpy8I GTNNAC 3 cut(s) 99, 556, 596
HpyAV CCTTC 2 cut(s) 15, 502
HpyCH4III ACNGT 2 cut(s) 251, 288
HpyCH4V TGCA 7 cut(s) 56, 229, 317, 366, 410, 467, 562
HpyF10VI GCNNNNNNNGC 1 cut(s) 586
HpyF3I CTNAG 3 cut(s) 45, 77, 398
Hsp92II CATG 4 cut(s) 60, 278, 321, 568
Kzo9I GATC 1 cut(s) 581
LmnI GCTCC 3 cut(s) 116, 185, 321
LweI GCATC 3 cut(s) 216, 333, 375
MalI GATC 1 cut(s) 583
MboI GATC 1 cut(s) 581
MboII GAAGA 3 cut(s) 493, 619, 622
MluCI AATT 1 cut(s) 361
MmeI TCCRAC 2 cut(s) 39, 307
MnlI CCTC 7 cut(s) 149, 231, 234, 271, 325, 438, 612
MspR9I CCNGG 2 cut(s) 432, 451
Mva1269I GAATGC 1 cut(s) 410
MvaI CCWGG 2 cut(s) 432, 451
MwoI GCNNNNNNNGC 1 cut(s) 586
NdeII GATC 1 cut(s) 581
NlaIII CATG 4 cut(s) 60, 278, 321, 568
NlaIV GGNNCC 3 cut(s) 118, 187, 201
NmeAIII GCCGAG 1 cut(s) 228
PctI GAATGC 1 cut(s) 410
PfeI GAWTC 1 cut(s) 217
PflMI CCANNNNNTGG 1 cut(s) 57
PsiI TTATAA 1 cut(s) 305
Psp6I CCWGG 2 cut(s) 430, 449
PspFI CCCAGC 1 cut(s) 589
PspGI CCWGG 2 cut(s) 430, 449
PspN4I GGNNCC 3 cut(s) 118, 187, 201
PspPI GGNCC 1 cut(s) 280
RsaI GTAC 4 cut(s) 404, 461, 488, 557
RsaNI GTAC 4 cut(s) 403, 460, 487, 556
Sau3AI GATC 1 cut(s) 581
Sau96I GGNCC 1 cut(s) 280
ScaI AGTACT 1 cut(s) 488
ScrFI CCNGG 2 cut(s) 432, 451
SfaNI GCATC 3 cut(s) 216, 333, 375
SinI GGWCC 1 cut(s) 280
SmlI CTYRAG 1 cut(s) 82
SmoI CTYRAG 1 cut(s) 82
Sse9I AATT 1 cut(s) 361
SsiI CCGC 1 cut(s) 380
StyD4I CCNGG 2 cut(s) 430, 449
StyI CCWWGG 2 cut(s) 102, 383
TaaI ACNGT 2 cut(s) 251, 288
TasI AATT 1 cut(s) 361
TatI WGTACW 2 cut(s) 459, 486
TfiI GAWTC 1 cut(s) 217
TscAI CASTG 2 cut(s) 94, 334
TspGWI ACGGA 1 cut(s) 198
TspRI CASTG 2 cut(s) 94, 334
Van91I CCANNNNNTGG 1 cut(s) 57
VpaK11BI GGWCC 1 cut(s) 280
ZrmI AGTACT 1 cut(s) 488
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.