Rroxscaffold_1G00017820

Catalyzes the third of the four reactions of the long- chain fatty acids elongation cycle. This endoplasmic reticulum- bound enzymatic process, allows the addition of two carbons to the chain of long- and very long-chain fatty acids VLCFAs per cycle. This enzyme catalyzes the dehydration of the 3-hydroxyacyl-CoA intermediate into trans-2,3-enoyl-CoA, within each cycle of fatty acid elongation. Thereby, it participates to the production of VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0010281
Physical Location & Seq
Forward (+)
21847552 .. 21851503
3952 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00017820.1

Sequence Viewer

Length: 648 bp
ATGCCTTCTGTATCCAATATCTATCTCTTGGCCTACAACTCTGCTCAGGCCATTGCATGGGCAGTTTCTCTCTCTCTAAGCTTGAGCAGTGTGCTGTCCACCAAGGGGGTCAATGGAGCCTATGCTTCTGCTGGAGACCTCATCTATTTGTGCCAGATGGTTGCGTTCTTGGAAGTTATACACGGAGCCATTGGTCTGGTGCCGAGTGGAGTGGTGATTCCTCTGATGCAATGGGCAGGAAGGACAAACTGTATTTTTGTAATGCGTCAAACCCATGAGGTCCAAGAGCTGCCAGCAGTCTTGATAACTTTTGTTGCATGGAGCATAAGTGAGATTATTAGATATCCAAACTACGCTTTGAATTGCATTGGAAGTTGTCCGCCTTGGCTTACCTATCTCAGGTACTCTGCATTCCTTGTCTTGTATCCTCCTGGGATGGGTGGTGAAACCTGGATTATGTACTATGCACTTCCATTTATGAAGAAGCACTCCTTCAGATATTATAGTTTTCTGATGTATTCATTGGAGAATCTTCTGATCCAGGTTGTGCTTTTCTGCTACCCTGTCCTCTGTTTGAAAGTTTACCTGCATATGGTCACGCAACGGCGATCGAAGCTGGGTAAACAAGACAAGAAGAAGAAGAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00062 ko01040 ko01110 ko01212 map00062 map01040 map01110 map01212
Pfam Domains
Protein Families
PTPLA

Protein Analysis

215

Amino Acids

24.33

Weight (kDa)

9.36

Isoelectric Point (pI)

39.0

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PTPLA PF04387 52 - 208 7.4e-46 Protein tyrosine phosphatase-like protein, PTPLA
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 594
AccB1I GGYRCC 1 cut(s) 199
AccB7I CCANNNNNTGG 1 cut(s) 57
AciI CCGC 1 cut(s) 380
AclWI GGATC 1 cut(s) 532
AcuI CTGAAG 1 cut(s) 478
AfaI GTAC 2 cut(s) 404, 461
AfiI CCNNNNNNNGG 5 cut(s) 57, 105, 399, 437, 592
AgsI TTSAA 2 cut(s) 361, 577
AjnI CCWGG 3 cut(s) 430, 449, 540
AluBI AGCT 3 cut(s) 81, 289, 616
AluI AGCT 3 cut(s) 81, 289, 616
Alw26I GTCTC 1 cut(s) 129
AlwI GGATC 1 cut(s) 532
AoxI GGCC 2 cut(s) 30, 48
ApeKI GCWGC 1 cut(s) 289
AspS9I GGNCC 1 cut(s) 280
AsuHPI GGTGA 2 cut(s) 226, 455
AvaII GGWCC 1 cut(s) 280
BanI GGYRCC 1 cut(s) 199
BbvI GCAGC 1 cut(s) 276
BccI CCATC 2 cut(s) 151, 430
BceAI ACGGC 1 cut(s) 620
BciT130I CCWGG 3 cut(s) 432, 451, 542
BciVI GTATCC 2 cut(s) 22, 435
BcoDI GTCTC 1 cut(s) 129
BfuAI ACCTGC 1 cut(s) 594
BfuI GTATCC 2 cut(s) 22, 435
BisI GCNGC 1 cut(s) 290
BlsI GCNGC 1 cut(s) 291
Bme1390I CCNGG 3 cut(s) 432, 451, 542
Bme18I GGWCC 1 cut(s) 280
BmgT120I GGNCC 1 cut(s) 280
BmiI GGNNCC 3 cut(s) 118, 187, 201
BmrFI CCNGG 3 cut(s) 432, 451, 542
BmsI GCATC 1 cut(s) 216
BpmI CTGGAG 1 cut(s) 153
Bpu10I CCTNAGC 1 cut(s) 45
BpuEI CTTGAG 1 cut(s) 103
BsaI GGTCTC 1 cut(s) 129
BsaJI CCNNGG 3 cut(s) 102, 383, 431
BsaXI ACNNNNNCTCC 2 cut(s) 313, 343
Bsc4I CCNNNNNNNGG 5 cut(s) 57, 105, 399, 437, 592
Bse3DI GCAATG 2 cut(s) 51, 236
BseBI CCWGG 3 cut(s) 432, 451, 542
BseDI CCNNGG 3 cut(s) 102, 383, 431
BseGI GGATG 1 cut(s) 441
BseLI CCNNNNNNNGG 5 cut(s) 57, 105, 399, 437, 592
BseMI GCAATG 2 cut(s) 51, 236
BseMII CTCAG 2 cut(s) 59, 412
BseXI GCAGC 1 cut(s) 276
BseYI CCCAGC 1 cut(s) 616
Bsh1285I CGRYCG 1 cut(s) 611
BshFI GGCC 2 cut(s) 32, 50
BshNI GGYRCC 1 cut(s) 199
BsiEI CGRYCG 1 cut(s) 611
BslI CCNNNNNNNGG 5 cut(s) 57, 105, 399, 437, 592
BsmAI GTCTC 1 cut(s) 129
BsmI GAATGC 1 cut(s) 410
BsnI GGCC 2 cut(s) 32, 50
Bso31I GGTCTC 1 cut(s) 129
Bsp143I GATC 2 cut(s) 537, 608
BspACI CCGC 1 cut(s) 380
BspANI GGCC 2 cut(s) 32, 50
BspCNI CTCAG 2 cut(s) 58, 411
BspLI GGNNCC 3 cut(s) 118, 187, 201
BspMI ACCTGC 1 cut(s) 594
BspPI GGATC 1 cut(s) 532
BspT107I GGYRCC 1 cut(s) 199
BspTNI GGTCTC 1 cut(s) 129
BsrDI GCAATG 2 cut(s) 51, 236
BssECI CCNNGG 3 cut(s) 102, 383, 431
BssMI GATC 2 cut(s) 537, 608
BssT1I CCWWGG 2 cut(s) 102, 383
Bst2UI CCWGG 3 cut(s) 432, 451, 542
Bst4CI ACNGT 1 cut(s) 251
Bst6I CTCTTC 1 cut(s) 635
BstC8I GCNNGC 1 cut(s) 294
BstDEI CTNAG 3 cut(s) 45, 77, 398
BstENI CCTNNNNNAGG 1 cut(s) 397
BstF5I GGATG 1 cut(s) 441
BstKTI GATC 2 cut(s) 540, 611
BstMAI GTCTC 1 cut(s) 129
BstMBI GATC 2 cut(s) 537, 608
BstMCI CGRYCG 1 cut(s) 611
BstMWI GCNNNNNNNGC 1 cut(s) 613
BstNI CCWGG 3 cut(s) 432, 451, 542
BstSCI CCNGG 3 cut(s) 430, 449, 540
BstV1I GCAGC 1 cut(s) 276
BstXI CCANNNNNNTGG 1 cut(s) 196
BsuI GTATCC 2 cut(s) 22, 435
BsuRI GGCC 2 cut(s) 32, 50
BtsCI GGATG 1 cut(s) 441
BtsI GCAGTG 1 cut(s) 94
BtsIMutI CAGTG 1 cut(s) 94
BveI ACCTGC 1 cut(s) 594
Cac8I GCNNGC 1 cut(s) 294
Cfr13I GGNCC 1 cut(s) 280
CseI GACGC 1 cut(s) 254
Csp6I GTAC 2 cut(s) 403, 460
CviAII CATG 3 cut(s) 57, 275, 318
CviJI RGCY 8 cut(s) 32, 50, 81, 119, 188, 289, 388, 616
CviKI_1 RGCY 8 cut(s) 32, 50, 81, 119, 188, 289, 388, 616
CviQI GTAC 2 cut(s) 403, 460
DdeI CTNAG 3 cut(s) 45, 77, 398
DpnI GATC 2 cut(s) 539, 610
DpnII GATC 2 cut(s) 537, 608
Eam1104I CTCTTC 1 cut(s) 635
EarI CTCTTC 1 cut(s) 635
EciI GGCGGA 1 cut(s) 369
Eco130I CCWWGG 2 cut(s) 102, 383
Eco31I GGTCTC 1 cut(s) 129
Eco32I GATATC 1 cut(s) 344
Eco47I GGWCC 1 cut(s) 280
Eco57I CTGAAG 1 cut(s) 478
EcoNI CCTNNNNNAGG 1 cut(s) 397
EcoRII CCWGG 3 cut(s) 430, 449, 540
EcoRV GATATC 1 cut(s) 344
EcoT14I CCWWGG 2 cut(s) 102, 383
ErhI CCWWGG 2 cut(s) 102, 383
FaeI CATG 3 cut(s) 60, 278, 321
FalI AAGNNNNNCTT 2 cut(s) 476, 508
FatI CATG 3 cut(s) 56, 274, 317
FauNDI CATATG 1 cut(s) 591
Fnu4HI GCNGC 1 cut(s) 290
FokI GGATG 1 cut(s) 448
Fsp4HI GCNGC 1 cut(s) 290
GluI GCNGC 1 cut(s) 290
GsaI CCCAGC 1 cut(s) 620
GsuI CTGGAG 1 cut(s) 153
HaeIII GGCC 2 cut(s) 32, 50
HgaI GACGC 1 cut(s) 254
Hin1II CATG 3 cut(s) 60, 278, 321
HindIII AAGCTT 1 cut(s) 79
HinfI GANTC 2 cut(s) 217, 529
HphI GGTGA 2 cut(s) 226, 455
Hpy166II GTNNAC 3 cut(s) 99, 583, 623
Hpy188I TCNGA 4 cut(s) 225, 497, 513, 537
Hpy188III TCNNGA 1 cut(s) 301
Hpy8I GTNNAC 3 cut(s) 99, 583, 623
HpyAV CCTTC 3 cut(s) 15, 234, 502
HpyCH4III ACNGT 1 cut(s) 251
HpyCH4V TGCA 7 cut(s) 56, 229, 317, 366, 410, 467, 589
HpyF10VI GCNNNNNNNGC 1 cut(s) 613
HpyF3I CTNAG 3 cut(s) 45, 77, 398
Hsp92II CATG 3 cut(s) 60, 278, 321
Kzo9I GATC 2 cut(s) 537, 608
LmnI GCTCC 3 cut(s) 116, 185, 321
Lsp1109I GCAGC 1 cut(s) 276
LweI GCATC 1 cut(s) 216
MaeIII GTNAC 1 cut(s) 595
MalI GATC 2 cut(s) 539, 610
MboI GATC 2 cut(s) 537, 608
MboII GAAGA 3 cut(s) 493, 524, 646
MluCI AATT 1 cut(s) 361
MnlI CCTC 6 cut(s) 149, 231, 271, 438, 578, 636
MspR9I CCNGG 3 cut(s) 432, 451, 542
Mva1269I GAATGC 1 cut(s) 410
MvaI CCWGG 3 cut(s) 432, 451, 542
MwoI GCNNNNNNNGC 1 cut(s) 613
NdeI CATATG 1 cut(s) 591
NdeII GATC 2 cut(s) 537, 608
NlaIII CATG 3 cut(s) 60, 278, 321
NlaIV GGNNCC 3 cut(s) 118, 187, 201
NmeAIII GCCGAG 1 cut(s) 228
NmuCI GTSAC 1 cut(s) 595
PctI GAATGC 1 cut(s) 410
PfeI GAWTC 2 cut(s) 217, 529
PflMI CCANNNNNTGG 1 cut(s) 57
PkrI GCNGC 1 cut(s) 291
Ple19I CGATCG 1 cut(s) 611
Psp6I CCWGG 3 cut(s) 430, 449, 540
PspFI CCCAGC 1 cut(s) 616
PspGI CCWGG 3 cut(s) 430, 449, 540
PspN4I GGNNCC 3 cut(s) 118, 187, 201
PspPI GGNCC 1 cut(s) 280
PvuI CGATCG 1 cut(s) 611
RsaI GTAC 2 cut(s) 404, 461
RsaNI GTAC 2 cut(s) 403, 460
SatI GCNGC 1 cut(s) 290
Sau3AI GATC 2 cut(s) 537, 608
Sau96I GGNCC 1 cut(s) 280
ScrFI CCNGG 3 cut(s) 432, 451, 542
SfaNI GCATC 1 cut(s) 216
SinI GGWCC 1 cut(s) 280
SmlI CTYRAG 1 cut(s) 82
SmoI CTYRAG 1 cut(s) 82
Sse9I AATT 1 cut(s) 361
SsiI CCGC 1 cut(s) 380
StyD4I CCNGG 3 cut(s) 430, 449, 540
StyI CCWWGG 2 cut(s) 102, 383
TaaI ACNGT 1 cut(s) 251
TaqI TCGA 1 cut(s) 611
TasI AATT 1 cut(s) 361
TatI WGTACW 1 cut(s) 459
TfiI GAWTC 2 cut(s) 217, 529
TscAI CASTG 1 cut(s) 94
TseFI GTSAC 1 cut(s) 595
TseI GCWGC 1 cut(s) 289
Tsp45I GTSAC 1 cut(s) 595
TspDTI ATGAA 2 cut(s) 494, 510
TspGWI ACGGA 1 cut(s) 198
TspRI CASTG 1 cut(s) 94
Van91I CCANNNNNTGG 1 cut(s) 57
VpaK11BI GGWCC 1 cut(s) 280
XagI CCTNNNNNAGG 1 cut(s) 397
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.