Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr11

Orthogroup ID

OG0003130

Physical Location & Seq

Genomic Coordinates Reverse (-)

10795916 .. 10797564

Gene Structure 1649 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom11g11930.4

Sequence Viewer

CDS Protein Promoter (2k)

Length: 612 bp

ATGATCGATCATGTAAGAGCTGTTGAACCACCATTTGACTACATCATTGGAACTGATGTTGTCTATAAAGAAAATCTGTTGGAACCATTGTTGCAGACAATACATGCATTATCAGGGCCGAAAACTACAATTTTGATGGGGTATGAGATTCGATCTACAAGTGTCCATGAACAAATGCTTCAAATGTGGAAAAGAAACTTCGAGGTGAAAACTGTTCCAAATTCAAAGATGGACAGTACCTACCAACATCCAGATATTCAACTTTACATTATGACATTAAAGCCTCCGGAGGGTTACGCAGAAAACGCAGCTGAGGTGATTGATCAGAATGAGGATGAAGTGGAGGGTGGTGCAGAAGAAGTGGATAAGGTGATTGATCAGAAAGTTGATGAAGCAAATACAAGTGAAGAAAACGCAGTTAATGTGATTGATCAGAAAGTTGATGAAGCTGAGAGCCGTAAGGAAAAAGGTGACACTGGTTCCCTCGATGAAAATGTTGAGGAAGATTGTGAGCCAATGACAAGGCTTCAGAATGATAAACTTACTGATTGGGAAGCTAGAAGGTATGGTTCAATGGCTGCGCGCCTTCTTCACGACATCAAAATTACCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Methyltransf_16

Protein Analysis

204

Amino Acids

23.15

Weight (kDa)

4.48

Isoelectric Point (pI)

34.42

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003130)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G08125 AT1G08125 AT1G08125 AT1G08125
fragaria_vesca	FvH4_3g30920 FvH4_3g30920 FvH4_3g30920 FvH4_3g30920 FvH4_3g30920 FvH4_3g30920 FvH4_3g30920
malus_domestica	MD11G1146300.v1.1
prunus_persica	Prupe.6G109400_v2.0.a1 Prupe.6G109400_v2.0.a1 Prupe.6G109400_v2.0.a1 Prupe.6G109400_v2.0.a1 Prupe.6G109400_v2.0.a1 Prupe.6G109400_v2.0.a1 Prupe.6G109400_v2.0.a1 Prupe.6G109400_v2.0.a1 Prupe.6G109400_v2.0.a1 Prupe.6G109400_v2.0.a1 Prupe.6G109400_v2.0.a1
pyrus_communis	pycom11g11930
rosa_chinensis	RchiOBHm_Chr5g0057461
rosa_laevigata	RLG00000035156
rosa_multiflora	Rmu_sc0000508.1_g000013 Rmu_sc0003730.1_g000018 Rmu_sc0003730.1_g000019
rosa_roxburghii	Rroxscaffold_1G00022990
rosa_rugosa	Rorug05G0307400 Rorug05G0307400
rosa_samantha	Rh5AG376000 Rh5BG386800 Rh5CG410300 Rh5DG401100
rosa_wichuraiana	Rw5G035500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	583
AccIII	TCCGGA	1 cut(s)	286
AcsI	RAATTY	1 cut(s)	220
AcuI	CTGAAG	1 cut(s)	512
AfaI	GTAC	1 cut(s)	238
AfiI	CCNNNNNNNGG	1 cut(s)	290
AgsI	TTSAA	5 cut(s)	26, 182, 225, 260, 573
AluBI	AGCT	4 cut(s)	20, 311, 449, 557
AluI	AGCT	4 cut(s)	20, 311, 449, 557
Aor13HI	TCCGGA	1 cut(s)	286
AoxI	GGCC	1 cut(s)	116
ApeKI	GCWGC	2 cut(s)	308, 578
ApoI	RAATTY	1 cut(s)	220
AspLEI	GCGC	2 cut(s)	583, 585
AspS9I	GGNCC	1 cut(s)	116
AsuHPI	GGTGA	4 cut(s)	217, 328, 382, 482
BbvCI	CCTCAGC	1 cut(s)	312
BbvI	GCAGC	2 cut(s)	320, 565
BccI	CCATC	2 cut(s)	130, 223
BceAI	ACGGC	1 cut(s)	441
BclI	TGATCA	3 cut(s)	322, 376, 430
BfaI	CTAG	1 cut(s)	558
BisI	GCNGC	2 cut(s)	309, 579
BlsI	GCNGC	2 cut(s)	310, 580
BmgT120I	GGNCC	1 cut(s)	116
BmiI	GGNNCC	2 cut(s)	84, 481
Bpu10I	CCTNAGC	1 cut(s)	312
Bsa29I	ATCGAT	1 cut(s)	6
BsaWI	WCCGGW	1 cut(s)	286
Bsc4I	CCNNNNNNNGG	1 cut(s)	290
Bse1I	ACTGG	1 cut(s)	481
BseAI	TCCGGA	1 cut(s)	286
BseCI	ATCGAT	1 cut(s)	6
BseGI	GGATG	2 cut(s)	247, 340
BseLI	CCNNNNNNNGG	1 cut(s)	290
BseMII	CTCAG	2 cut(s)	303, 441
BseNI	ACTGG	1 cut(s)	481
BsePI	GCGCGC	1 cut(s)	581
BseXI	GCAGC	2 cut(s)	320, 565
BsgI	GTGCAG	1 cut(s)	372
Bsh1236I	CGCG	1 cut(s)	583
BshFI	GGCC	1 cut(s)	118
BshVI	ATCGAT	1 cut(s)	6
BsiSI	CCGG	1 cut(s)	287
BslI	CCNNNNNNNGG	1 cut(s)	290
BsnI	GGCC	1 cut(s)	118
Bsp13I	TCCGGA	1 cut(s)	286
Bsp143I	GATC	6 cut(s)	3, 7, 152, 322, 376, 430
BspANI	GGCC	1 cut(s)	118
BspCNI	CTCAG	2 cut(s)	304, 442
BspDI	ATCGAT	1 cut(s)	6
BspEI	TCCGGA	1 cut(s)	286
BspFNI	CGCG	1 cut(s)	583
BspLI	GGNNCC	2 cut(s)	84, 481
BsrI	ACTGG	1 cut(s)	481
BssHII	GCGCGC	1 cut(s)	581
BssMI	GATC	6 cut(s)	3, 7, 152, 322, 376, 430
Bst4CI	ACNGT	2 cut(s)	214, 236
BstC8I	GCNNGC	1 cut(s)	583
BstDEI	CTNAG	2 cut(s)	312, 450
BstF5I	GGATG	2 cut(s)	247, 340
BstFNI	CGCG	1 cut(s)	583
BstHHI	GCGC	2 cut(s)	583, 585
BstKTI	GATC	6 cut(s)	6, 10, 155, 325, 379, 433
BstMBI	GATC	6 cut(s)	3, 7, 152, 322, 376, 430
BstMWI	GCNNNNNNNGC	1 cut(s)	305
BstNSI	RCATGY	1 cut(s)	107
BstUI	CGCG	1 cut(s)	583
BstV1I	GCAGC	2 cut(s)	320, 565
Bsu15I	ATCGAT	1 cut(s)	6
BsuRI	GGCC	1 cut(s)	118
BsuTUI	ATCGAT	1 cut(s)	6
BtsCI	GGATG	2 cut(s)	247, 340
BtsIMutI	CAGTG	1 cut(s)	474
Cac8I	GCNNGC	1 cut(s)	583
CfoI	GCGC	2 cut(s)	583, 585
Cfr13I	GGNCC	1 cut(s)	116
ClaI	ATCGAT	1 cut(s)	6
Csp6I	GTAC	1 cut(s)	237
CviAII	CATG	3 cut(s)	11, 104, 167
CviQI	GTAC	1 cut(s)	237
DdeI	CTNAG	2 cut(s)	312, 450
DpnI	GATC	6 cut(s)	5, 9, 154, 324, 378, 432
DpnII	GATC	6 cut(s)	3, 7, 152, 322, 376, 430
Eco57I	CTGAAG	1 cut(s)	512
EcoT22I	ATGCAT	1 cut(s)	109
FaeI	CATG	3 cut(s)	14, 107, 170
FaiI	YATR	7 cut(s)	12, 66, 105, 144, 168, 272, 567
FatI	CATG	3 cut(s)	10, 103, 166
FbaI	TGATCA	3 cut(s)	322, 376, 430
Fnu4HI	GCNGC	2 cut(s)	309, 579
FokI	GGATG	2 cut(s)	234, 347
Fsp4HI	GCNGC	2 cut(s)	309, 579
FspBI	CTAG	1 cut(s)	558
GlaI	GCGC	2 cut(s)	582, 584
GluI	GCNGC	2 cut(s)	309, 579
HaeIII	GGCC	1 cut(s)	118
HapII	CCGG	1 cut(s)	287
HhaI	GCGC	2 cut(s)	583, 585
Hin1II	CATG	3 cut(s)	14, 107, 170
Hin6I	GCGC	2 cut(s)	581, 583
HinP1I	GCGC	2 cut(s)	581, 583
HinfI	GANTC	1 cut(s)	148
HpaII	CCGG	1 cut(s)	287
HphI	GGTGA	4 cut(s)	217, 328, 382, 482
Hpy188I	TCNGA	4 cut(s)	327, 381, 435, 531
Hpy188III	TCNNGA	3 cut(s)	251, 287, 593
HpyAV	CCTTC	2 cut(s)	555, 596
HpyCH4III	ACNGT	2 cut(s)	214, 236
HpyCH4V	TGCA	3 cut(s)	94, 107, 353
HpyF10VI	GCNNNNNNNGC	1 cut(s)	305
HpyF3I	CTNAG	2 cut(s)	312, 450
Hsp92II	CATG	3 cut(s)	14, 107, 170
HspAI	GCGC	2 cut(s)	581, 583
Kpn2I	TCCGGA	1 cut(s)	286
Ksp22I	TGATCA	3 cut(s)	322, 376, 430
Kzo9I	GATC	6 cut(s)	3, 7, 152, 322, 376, 430
LpnPI	CCDG	4 cut(s)	99, 264, 300, 462
Lsp1109I	GCAGC	2 cut(s)	320, 565
MaeI	CTAG	1 cut(s)	558
MaeIII	GTNAC	2 cut(s)	293, 470
MalI	GATC	6 cut(s)	5, 9, 154, 324, 378, 432
MboI	GATC	6 cut(s)	3, 7, 152, 322, 376, 430
MboII	GAAGA	4 cut(s)	368, 419, 515, 581
MluCI	AATT	3 cut(s)	129, 220, 603
MmeI	TCCRAC	1 cut(s)	60
MnlI	CCTC	8 cut(s)	196, 283, 294, 307, 325, 337, 493, 494
Mph1103I	ATGCAT	1 cut(s)	109
MroI	TCCGGA	1 cut(s)	286
MseI	TTAA	2 cut(s)	278, 420
MspA1I	CMGCKG	1 cut(s)	311
MspI	CCGG	1 cut(s)	287
MvnI	CGCG	1 cut(s)	583
MwoI	GCNNNNNNNGC	1 cut(s)	305
NdeII	GATC	6 cut(s)	3, 7, 152, 322, 376, 430
NlaIII	CATG	3 cut(s)	14, 107, 170
NlaIV	GGNNCC	2 cut(s)	84, 481
NmuCI	GTSAC	1 cut(s)	470
NsiI	ATGCAT	1 cut(s)	109
NspI	RCATGY	1 cut(s)	107
PauI	GCGCGC	1 cut(s)	581
PfeI	GAWTC	1 cut(s)	148
PkrI	GCNGC	2 cut(s)	310, 580
PspN4I	GGNNCC	2 cut(s)	84, 481
PspPI	GGNCC	1 cut(s)	116
PteI	GCGCGC	1 cut(s)	581
PvuII	CAGCTG	1 cut(s)	311
RsaI	GTAC	1 cut(s)	238
RsaNI	GTAC	1 cut(s)	237
SaqAI	TTAA	2 cut(s)	278, 420
SatI	GCNGC	2 cut(s)	309, 579
Sau3AI	GATC	6 cut(s)	3, 7, 152, 322, 376, 430
Sau96I	GGNCC	1 cut(s)	116
Sse9I	AATT	3 cut(s)	129, 220, 603
SspMI	CTAG	1 cut(s)	558
TaaI	ACNGT	2 cut(s)	214, 236
TaqI	TCGA	4 cut(s)	6, 151, 201, 486
TasI	AATT	3 cut(s)	129, 220, 603
TfiI	GAWTC	1 cut(s)	148
Tru1I	TTAA	2 cut(s)	278, 420
Tru9I	TTAA	2 cut(s)	278, 420
TscAI	CASTG	1 cut(s)	481
TseFI	GTSAC	1 cut(s)	470
TseI	GCWGC	2 cut(s)	308, 578
Tsp45I	GTSAC	1 cut(s)	470
TspDTI	ATGAA	5 cut(s)	183, 351, 405, 459, 504
TspRI	CASTG	1 cut(s)	481
XapI	RAATTY	1 cut(s)	220
XceI	RCATGY	1 cut(s)	107
XspI	CTAG	1 cut(s)	558
Zsp2I	ATGCAT	1 cut(s)	109

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.