Rh5BG386800

Protein-lysine methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
61769014 .. 61773983
4970 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG386800.1

Sequence Viewer

Length: 660 bp
ATGGAACCCGACAGGTTGAACTCGCCCAGCACATTTACAATGGATTTGGAAGTTTTGGGGCATGAGTTGCAGTTCATTCAGGATCCTAATTCCAAGCATCTAGGAACTACAGTTTGGGATGCATCACTGGTATTCGCCAAGTTTCTGGAAAAGAATTCCAGAAGGGGTAAGTTCTCCCCGTCAAAACTTAAAGGGAAACGTGTCATTGAACTTGGAGCAGGTTGTGGAGTAGCAGGGTTTGGCATGGCATTACTGGGATGTGATGTGGTTATGACAGATCAAGTTGAGGTTTTGCCATTGCTAATGAGAAATGTTGAACGGAATACTTCAAGGATTACACAGATGAATCCTGGTTCTGAGTCATTTGGTTCGGTCCAGGTAGCAGAGTTAAATTGGGGAAATGAGGATCATATAAGAGCCGTTGATCCGCCATTTGACTACATCATTGGCACTGACGTTGTTTACAAAGAAGATCTCTTGGAGCCACTGTTGCAGACAATATTTGCATTGTCAGGGCCTAAAACTGCAATTTTGCTGGGCTATGAGATTCGTTCTACAAGTGTCCATGAGCAAATGGTTGAAATGTGGAAAAGACACTTCGAGGTGAAACTTGTTCCAAATTCTAAGGTACAGTTTAGTTTTTCAGATGCAATGCGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

219

Amino Acids

24.55

Weight (kDa)

5.58

Isoelectric Point (pI)

37.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Methyltransf_16 PF10294 22 - 190 4.1e-33 Lysine methyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 209
AciI CCGC 1 cut(s) 428
AclWI GGATC 4 cut(s) 77, 90, 414, 419
AcsI RAATTY 2 cut(s) 154, 619
AfaI GTAC 1 cut(s) 630
AflIII ACRYGT 1 cut(s) 199
AgsI TTSAA 5 cut(s) 19, 209, 317, 330, 581
AjnI CCWGG 2 cut(s) 349, 375
AjuI GAANNNNNNNTTGG 2 cut(s) 97, 129
AlwI GGATC 4 cut(s) 77, 90, 414, 419
AoxI GGCC 1 cut(s) 515
ApoI RAATTY 2 cut(s) 154, 619
AspS9I GGNCC 2 cut(s) 373, 515
AsuHPI GGTGA 1 cut(s) 616
AvaII GGWCC 1 cut(s) 373
BamHI GGATCC 1 cut(s) 82
BceAI ACGGC 1 cut(s) 404
BciT130I CCWGG 2 cut(s) 351, 377
BfaI CTAG 1 cut(s) 101
BfmI CTRYAG 1 cut(s) 108
BfuAI ACCTGC 1 cut(s) 209
BglII AGATCT 1 cut(s) 472
Bme1390I CCNGG 2 cut(s) 351, 377
Bme18I GGWCC 1 cut(s) 373
BmgT120I GGNCC 2 cut(s) 373, 515
BmiI GGNNCC 3 cut(s) 6, 84, 483
BmrFI CCNGG 2 cut(s) 351, 377
BmrI ACTGGG 1 cut(s) 263
BmsI GCATC 4 cut(s) 106, 109, 131, 637
BmuI ACTGGG 1 cut(s) 263
BsaXI ACNNNNNCTCC 2 cut(s) 473, 503
Bse1I ACTGG 2 cut(s) 132, 258
Bse3DI GCAATG 2 cut(s) 296, 657
BseBI CCWGG 2 cut(s) 351, 377
BseGI GGATG 2 cut(s) 124, 263
BseMI GCAATG 2 cut(s) 296, 657
BseMII CTCAG 1 cut(s) 348
BseNI ACTGG 2 cut(s) 132, 258
BseYI CCCAGC 2 cut(s) 26, 535
BshFI GGCC 1 cut(s) 517
BsnI GGCC 1 cut(s) 517
Bsp143I GATC 5 cut(s) 82, 277, 406, 424, 472
BspACI CCGC 1 cut(s) 428
BspANI GGCC 1 cut(s) 517
BspCNI CTCAG 1 cut(s) 349
BspLI GGNNCC 3 cut(s) 6, 84, 483
BspMI ACCTGC 1 cut(s) 209
BspPI GGATC 4 cut(s) 77, 90, 414, 419
BsrDI GCAATG 2 cut(s) 296, 657
BsrI ACTGG 2 cut(s) 132, 258
BssMI GATC 5 cut(s) 82, 277, 406, 424, 472
Bst2UI CCWGG 2 cut(s) 351, 377
Bst4CI ACNGT 3 cut(s) 112, 489, 633
BstAPI GCANNNNNTGC 1 cut(s) 67
BstDEI CTNAG 2 cut(s) 357, 624
BstF5I GGATG 2 cut(s) 124, 263
BstKTI GATC 5 cut(s) 85, 280, 409, 427, 475
BstMBI GATC 5 cut(s) 82, 277, 406, 424, 472
BstMWI GCNNNNNNNGC 2 cut(s) 67, 490
BstNI CCWGG 2 cut(s) 351, 377
BstSCI CCNGG 2 cut(s) 349, 375
BstSFI CTRYAG 1 cut(s) 108
BstX2I RGATCY 2 cut(s) 82, 472
BstXI CCANNNNNNTGG 1 cut(s) 145
BstYI RGATCY 2 cut(s) 82, 472
BsuRI GGCC 1 cut(s) 517
BtsCI GGATG 2 cut(s) 124, 263
BtsIMutI CAGTG 3 cut(s) 125, 450, 485
BveI ACCTGC 1 cut(s) 209
Cfr13I GGNCC 2 cut(s) 373, 515
Csp6I GTAC 1 cut(s) 629
CviAII CATG 3 cut(s) 62, 244, 566
CviJI RGCY 4 cut(s) 419, 484, 517, 540
CviKI_1 RGCY 4 cut(s) 419, 484, 517, 540
CviQI GTAC 1 cut(s) 629
DdeI CTNAG 2 cut(s) 357, 624
DpnI GATC 5 cut(s) 84, 279, 408, 426, 474
DpnII GATC 5 cut(s) 82, 277, 406, 424, 472
EciI GGCGGA 1 cut(s) 417
Eco47I GGWCC 1 cut(s) 373
EcoO109I RGGNCCY 1 cut(s) 515
EcoRI GAATTC 1 cut(s) 154
EcoRII CCWGG 2 cut(s) 349, 375
EcoT22I ATGCAT 1 cut(s) 124
FaeI CATG 3 cut(s) 65, 247, 569
FaiI YATR 7 cut(s) 63, 245, 272, 411, 413, 543, 567
FatI CATG 3 cut(s) 61, 243, 565
FokI GGATG 2 cut(s) 131, 270
FspBI CTAG 1 cut(s) 101
GsaI CCCAGC 2 cut(s) 30, 539
HaeIII GGCC 1 cut(s) 517
Hin1II CATG 3 cut(s) 65, 247, 569
HinfI GANTC 3 cut(s) 346, 359, 547
HphI GGTGA 1 cut(s) 616
Hpy166II GTNNAC 1 cut(s) 463
Hpy188I TCNGA 2 cut(s) 358, 646
Hpy188III TCNNGA 3 cut(s) 80, 146, 159
Hpy8I GTNNAC 1 cut(s) 463
HpyAV CCTTC 1 cut(s) 156
HpyCH4III ACNGT 3 cut(s) 112, 489, 633
HpyCH4IV ACGT 2 cut(s) 199, 456
HpyCH4V TGCA 6 cut(s) 70, 122, 493, 506, 527, 650
HpyF10VI GCNNNNNNNGC 2 cut(s) 67, 490
HpyF3I CTNAG 2 cut(s) 357, 624
HpySE526I ACGT 2 cut(s) 199, 456
Hsp92II CATG 3 cut(s) 65, 247, 569
Kzo9I GATC 5 cut(s) 82, 277, 406, 424, 472
LmnI GCTCC 2 cut(s) 215, 481
LweI GCATC 4 cut(s) 106, 109, 131, 637
MaeI CTAG 1 cut(s) 101
MaeII ACGT 2 cut(s) 199, 456
MalI GATC 5 cut(s) 84, 279, 408, 426, 474
MboI GATC 5 cut(s) 82, 277, 406, 424, 472
MboII GAAGA 1 cut(s) 482
MflI RGATCY 2 cut(s) 82, 472
MluCI AATT 5 cut(s) 88, 154, 391, 528, 619
MlyI GAGTC 1 cut(s) 368
MnlI CCTC 3 cut(s) 280, 397, 595
Mph1103I ATGCAT 1 cut(s) 124
MseI TTAA 3 cut(s) 189, 389, 658
MspR9I CCNGG 2 cut(s) 351, 377
MvaI CCWGG 2 cut(s) 351, 377
MwoI GCNNNNNNNGC 2 cut(s) 67, 490
NdeII GATC 5 cut(s) 82, 277, 406, 424, 472
NlaIII CATG 3 cut(s) 65, 247, 569
NlaIV GGNNCC 3 cut(s) 6, 84, 483
NsiI ATGCAT 1 cut(s) 124
PfeI GAWTC 2 cut(s) 346, 547
PleI GAGTC 1 cut(s) 367
PpsI GAGTC 1 cut(s) 367
Psp6I CCWGG 2 cut(s) 349, 375
PspFI CCCAGC 2 cut(s) 26, 535
PspGI CCWGG 2 cut(s) 349, 375
PspN4I GGNNCC 3 cut(s) 6, 84, 483
PspPI GGNCC 2 cut(s) 373, 515
PsuI RGATCY 2 cut(s) 82, 472
RsaI GTAC 1 cut(s) 630
RsaNI GTAC 1 cut(s) 629
SaqAI TTAA 3 cut(s) 189, 389, 658
Sau3AI GATC 5 cut(s) 82, 277, 406, 424, 472
Sau96I GGNCC 2 cut(s) 373, 515
SchI GAGTC 1 cut(s) 368
ScrFI CCNGG 2 cut(s) 351, 377
SetI ASST 8 cut(s) 17, 202, 223, 291, 381, 459, 606, 630
SfaNI GCATC 4 cut(s) 106, 109, 131, 637
SfcI CTRYAG 1 cut(s) 108
SinI GGWCC 1 cut(s) 373
Sse9I AATT 5 cut(s) 88, 154, 391, 528, 619
SsiI CCGC 1 cut(s) 428
SspI AATATT 1 cut(s) 501
SspMI CTAG 1 cut(s) 101
StyD4I CCNGG 2 cut(s) 349, 375
TaaI ACNGT 3 cut(s) 112, 489, 633
TaiI ACGT 2 cut(s) 202, 459
TaqI TCGA 1 cut(s) 600
TaqII GACCGA 1 cut(s) 361
TasI AATT 5 cut(s) 88, 154, 391, 528, 619
TfiI GAWTC 2 cut(s) 346, 547
Tru1I TTAA 3 cut(s) 189, 389, 658
Tru9I TTAA 3 cut(s) 189, 389, 658
TscAI CASTG 3 cut(s) 132, 457, 492
TspDTI ATGAA 2 cut(s) 64, 359
TspGWI ACGGA 1 cut(s) 334
TspRI CASTG 3 cut(s) 132, 457, 492
VpaK11BI GGWCC 1 cut(s) 373
XapI RAATTY 2 cut(s) 154, 619
XspI CTAG 1 cut(s) 101
Zsp2I ATGCAT 1 cut(s) 124
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.