Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00012429

Orthogroup ID

OG0001252

Physical Location & Seq

Genomic Coordinates Forward (+)

38493 .. 39129

Gene Structure 637 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom12429g00040.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 459 bp

ATGAATCAGACTAAACATGGAGAAAGGTGGAGCTTCACAAAGGTTGTTTGCGTGAAGCCCACTACGAGGCCGGAGCGGAAGCCATCGGAGCGGGAGGCATCGGAGCTAGAGCATTCCAGGCCTCAATACTTGGCCAAGCGCTGGATGACCCAGGAAAAGGTGCCTCTGGAGATAAGACGCAAGCCTTTGACGGTCACTGTGAATTCGACCCTCAGATTCTTGCAGCTCATCAAGCTTCCTCTTCATCCCCGACGAATAGTTATTTGCAAGCACATGCAAACTTCTATTCTCGTACTTAAGCTGCTGGATCTCTTGCTTAAGTCTTTCCACCTCTGCCATCAACGATTCCACTTGGCGGGACCGAGCAAGCAGGCGTTGGCCCATGTTGGACACAGAACTCGCACACTGAACACTAAGTGCGAGGGACTCTTGAACGGCCAACTCATCGGACCGTCCTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005783 GO:0005789 GO:0008150 GO:0008152 GO:0012505 GO:0016020 GO:0016491 GO:0016705 GO:0031984 GO:0042175 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044425 GO:0044432 GO:0044444 GO:0044446 GO:0044464 GO:0045485 GO:0055114 GO:0098827

KEGG Pathways

Metabolic & Signaling

ko01040 ko01212 map01040 map01212

Pfam Domains

Protein Families

DUF3474 FA_desaturase

Protein Analysis

153

Amino Acids

17.63

Weight (kDa)

10.66

Isoelectric Point (pI)

40.31

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001252)

Species	Orthologous Gene IDs
pyrus_communis	pycom02g19100 pycom02g22930 pycom03g11160 pycom05g06380 pycom06g01440 pycom07g08770 pycom07g09280 pycom07g09480 pycom07g10240 pycom07g11270 pycom07g11980 pycom09g14200 pycom09g15110 pycom09g15730 pycom11g16170 pycom123g00010 pycom12429g00040 pycom1242g00140 pycom12438g00050 pycom12439g00010 pycom12457g00010 pycom12459g00040 pycom12460g00010 pycom12460g00040 pycom12468g00040 pycom12499g00020 pycom12499g00040 pycom12552g00050 pycom12556g00080 pycom12663g00010 pycom12678g00020 pycom1317g00010 pycom13g25440 pycom14g08150 pycom15g28910 pycom15g30880 pycom15g33340 pycom1654g00010 pycom16g17750 pycom16g22070 pycom16g24740 pycom17g09970 pycom1844g00140 pycom1958g00040 pycom2217g00030 pycom2309g00040 pycom2339g00090 pycom2595g00010 pycom2951g00010 pycom439g00050 pycom476g00040 pycom516g00010 pycom520g00230 pycom520g00720 pycom723g00020 pycom775g00030

Species

Orthologous Gene IDs

pyrus_communis

pycom02g19100 pycom02g22930 pycom03g11160 pycom05g06380 pycom06g01440 pycom07g08770 pycom07g09280 pycom07g09480 pycom07g10240 pycom07g11270 pycom07g11980 pycom09g14200 pycom09g15110 pycom09g15730 pycom11g16170 pycom123g00010 pycom12429g00040 pycom1242g00140 pycom12438g00050 pycom12439g00010 pycom12457g00010 pycom12459g00040 pycom12460g00010 pycom12460g00040 pycom12468g00040 pycom12499g00020 pycom12499g00040 pycom12552g00050 pycom12556g00080 pycom12663g00010 pycom12678g00020 pycom1317g00010 pycom13g25440 pycom14g08150 pycom15g28910 pycom15g30880 pycom15g33340 pycom1654g00010 pycom16g17750 pycom16g22070 pycom16g24740 pycom17g09970 pycom1844g00140 pycom1958g00040 pycom2217g00030 pycom2309g00040 pycom2339g00090 pycom2595g00010 pycom2951g00010 pycom439g00050 pycom476g00040 pycom516g00010 pycom520g00230 pycom520g00720 pycom723g00020 pycom775g00030

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	160
AccB7I	CCANNNNNTGG	1 cut(s)	141
AccBSI	CCGCTC	2 cut(s)	76, 91
AciI	CCGC	3 cut(s)	76, 91, 356
AclWI	GGATC	1 cut(s)	315
AcoI	YGGCCR	2 cut(s)	132, 436
AcsI	RAATTY	1 cut(s)	202
AdeI	CACNNNGTG	1 cut(s)	417
AfaI	GTAC	1 cut(s)	294
AfeI	AGCGCT	1 cut(s)	140
AfiI	CCNNNNNNNGG	4 cut(s)	66, 141, 157, 355
AflII	CTTAAG	2 cut(s)	296, 317
AgsI	TTSAA	1 cut(s)	433
AjnI	CCWGG	2 cut(s)	116, 150
AluBI	AGCT	5 cut(s)	33, 106, 226, 235, 301
AluI	AGCT	5 cut(s)	33, 106, 226, 235, 301
AlwI	GGATC	1 cut(s)	315
Aor51HI	AGCGCT	1 cut(s)	140
AoxI	GGCC	5 cut(s)	68, 119, 132, 378, 436
ApeKI	GCWGC	2 cut(s)	223, 301
ApoI	RAATTY	1 cut(s)	202
AspLEI	GCGC	1 cut(s)	141
AspS9I	GGNCC	3 cut(s)	359, 379, 449
AvaII	GGWCC	2 cut(s)	359, 449
BalI	TGGCCA	1 cut(s)	134
BanI	GGYRCC	1 cut(s)	160
BbvI	GCAGC	2 cut(s)	235, 288
BccI	CCATC	2 cut(s)	91, 345
BceAI	ACGGC	1 cut(s)	451
BciT130I	CCWGG	2 cut(s)	118, 152
BfaI	CTAG	1 cut(s)	107
BfoI	RGCGCY	1 cut(s)	142
BfrI	CTTAAG	2 cut(s)	296, 317
BisI	GCNGC	2 cut(s)	224, 302
BlsI	GCNGC	2 cut(s)	225, 303
Bme1390I	CCNGG	2 cut(s)	118, 152
Bme18I	GGWCC	2 cut(s)	359, 449
BmgT120I	GGNCC	3 cut(s)	359, 379, 449
BmiI	GGNNCC	2 cut(s)	162, 360
BmrFI	CCNGG	2 cut(s)	118, 152
BmsI	GCATC	1 cut(s)	107
BpmI	CTGGAG	1 cut(s)	188
BsaJI	CCNNGG	1 cut(s)	150
Bsc4I	CCNNNNNNNGG	4 cut(s)	66, 141, 157, 355
BseBI	CCWGG	2 cut(s)	118, 152
BseDI	CCNNGG	1 cut(s)	150
BseGI	GGATG	2 cut(s)	150, 244
BseLI	CCNNNNNNNGG	4 cut(s)	66, 141, 157, 355
BseMII	CTCAG	1 cut(s)	226
BseXI	GCAGC	2 cut(s)	235, 288
BshFI	GGCC	5 cut(s)	70, 121, 134, 380, 438
BshNI	GGYRCC	1 cut(s)	160
BsiSI	CCGG	1 cut(s)	71
BslFI	GGGAC	2 cut(s)	372, 438
BslI	CCNNNNNNNGG	4 cut(s)	66, 141, 157, 355
BsmFI	GGGAC	2 cut(s)	372, 438
BsmI	GAATGC	1 cut(s)	112
BsnI	GGCC	5 cut(s)	70, 121, 134, 380, 438
Bsp143I	GATC	1 cut(s)	307
BspACI	CCGC	3 cut(s)	76, 91, 356
BspANI	GGCC	5 cut(s)	70, 121, 134, 380, 438
BspCNI	CTCAG	1 cut(s)	225
BspLI	GGNNCC	2 cut(s)	162, 360
BspPI	GGATC	1 cut(s)	315
BspT107I	GGYRCC	1 cut(s)	160
BspTI	CTTAAG	2 cut(s)	296, 317
BsrBI	CCGCTC	2 cut(s)	76, 91
BssECI	CCNNGG	1 cut(s)	150
BssMI	GATC	1 cut(s)	307
Bst2UI	CCWGG	2 cut(s)	118, 152
Bst4CI	ACNGT	3 cut(s)	193, 199, 453
Bst6I	CTCTTC	1 cut(s)	246
BstAFI	CTTAAG	2 cut(s)	296, 317
BstC8I	GCNNGC	4 cut(s)	182, 269, 368, 372
BstDEI	CTNAG	2 cut(s)	212, 414
BstF5I	GGATG	2 cut(s)	150, 244
BstH2I	RGCGCY	1 cut(s)	142
BstHHI	GCGC	1 cut(s)	141
BstKTI	GATC	1 cut(s)	310
BstMBI	GATC	1 cut(s)	307
BstMWI	GCNNNNNNNGC	3 cut(s)	88, 118, 232
BstNI	CCWGG	2 cut(s)	118, 152
BstNSI	RCATGY	1 cut(s)	277
BstSCI	CCNGG	2 cut(s)	116, 150
BstV1I	GCAGC	2 cut(s)	235, 288
BstX2I	RGATCY	1 cut(s)	307
BstYI	RGATCY	1 cut(s)	307
BsuRI	GGCC	5 cut(s)	70, 121, 134, 380, 438
BtsCI	GGATG	2 cut(s)	150, 244
BtsIMutI	CAGTG	2 cut(s)	195, 404
Cac8I	GCNNGC	4 cut(s)	182, 269, 368, 372
CfoI	GCGC	1 cut(s)	141
Cfr13I	GGNCC	3 cut(s)	359, 379, 449
CpoI	CGGWCCG	1 cut(s)	449
CseI	GACGC	1 cut(s)	186
Csp6I	GTAC	1 cut(s)	293
CspI	CGGWCCG	1 cut(s)	449
CviAII	CATG	3 cut(s)	17, 274, 383
CviQI	GTAC	1 cut(s)	293
DdeI	CTNAG	2 cut(s)	212, 414
DpnI	GATC	1 cut(s)	309
DpnII	GATC	1 cut(s)	307
DraIII	CACNNNGTG	1 cut(s)	417
EaeI	YGGCCR	2 cut(s)	132, 436
Eam1104I	CTCTTC	1 cut(s)	246
EarI	CTCTTC	1 cut(s)	246
Eco147I	AGGCCT	1 cut(s)	121
Eco47I	GGWCC	2 cut(s)	359, 449
Eco47III	AGCGCT	1 cut(s)	140
EcoRI	GAATTC	1 cut(s)	202
EcoRII	CCWGG	2 cut(s)	116, 150
FaeI	CATG	3 cut(s)	20, 277, 386
FaiI	YATR	3 cut(s)	18, 275, 384
FaqI	GGGAC	2 cut(s)	372, 438
FatI	CATG	3 cut(s)	16, 273, 382
FauI	CCCGC	2 cut(s)	84, 349
Fnu4HI	GCNGC	2 cut(s)	224, 302
FokI	GGATG	2 cut(s)	157, 231
Fsp4HI	GCNGC	2 cut(s)	224, 302
FspBI	CTAG	1 cut(s)	107
GlaI	GCGC	1 cut(s)	140
GluI	GCNGC	2 cut(s)	224, 302
GsuI	CTGGAG	1 cut(s)	188
HaeII	RGCGCY	1 cut(s)	142
HaeIII	GGCC	5 cut(s)	70, 121, 134, 380, 438
HapII	CCGG	1 cut(s)	71
HgaI	GACGC	1 cut(s)	186
HhaI	GCGC	1 cut(s)	141
Hin1II	CATG	3 cut(s)	20, 277, 386
Hin6I	GCGC	1 cut(s)	139
HinP1I	GCGC	1 cut(s)	139
HindIII	AAGCTT	1 cut(s)	233
HinfI	GANTC	4 cut(s)	4, 216, 345, 426
HpaII	CCGG	1 cut(s)	71
Hpy188I	TCNGA	5 cut(s)	9, 88, 103, 215, 449
Hpy188III	TCNNGA	3 cut(s)	167, 430, 456
Hpy99I	CGWCG	1 cut(s)	255
HpyCH4III	ACNGT	3 cut(s)	193, 199, 453
HpyCH4V	TGCA	3 cut(s)	223, 267, 277
HpyF10VI	GCNNNNNNNGC	3 cut(s)	88, 118, 232
HpyF3I	CTNAG	2 cut(s)	212, 414
Hsp92II	CATG	3 cut(s)	20, 277, 386
HspAI	GCGC	1 cut(s)	139
Kzo9I	GATC	1 cut(s)	307
LmnI	GCTCC	4 cut(s)	30, 73, 88, 103
LpnPI	CCDG	9 cut(s)	84, 103, 127, 130, 137, 152, 164, 290, 356
Lsp1109I	GCAGC	2 cut(s)	235, 288
LweI	GCATC	1 cut(s)	107
MaeI	CTAG	1 cut(s)	107
MaeIII	GTNAC	1 cut(s)	193
MalI	GATC	1 cut(s)	309
MbiI	CCGCTC	2 cut(s)	76, 91
MboI	GATC	1 cut(s)	307
MboII	GAAGA	1 cut(s)	233
MflI	RGATCY	1 cut(s)	307
MlsI	TGGCCA	1 cut(s)	134
MluCI	AATT	1 cut(s)	202
MluNI	TGGCCA	1 cut(s)	134
MlyI	GAGTC	1 cut(s)	420
MmeI	TCCRAC	1 cut(s)	367
MnlI	CCTC	8 cut(s)	60, 88, 132, 174, 221, 249, 341, 415
Mox20I	TGGCCA	1 cut(s)	134
MscI	TGGCCA	1 cut(s)	134
MseI	TTAA	2 cut(s)	297, 318
Msp20I	TGGCCA	1 cut(s)	134
MspCI	CTTAAG	2 cut(s)	296, 317
MspI	CCGG	1 cut(s)	71
MspR9I	CCNGG	2 cut(s)	118, 152
Mva1269I	GAATGC	1 cut(s)	112
MvaI	CCWGG	2 cut(s)	118, 152
MwoI	GCNNNNNNNGC	3 cut(s)	88, 118, 232
NdeII	GATC	1 cut(s)	307
NlaIII	CATG	3 cut(s)	20, 277, 386
NlaIV	GGNNCC	2 cut(s)	162, 360
NmuCI	GTSAC	1 cut(s)	193
NspI	RCATGY	1 cut(s)	277
PceI	AGGCCT	1 cut(s)	121
PctI	GAATGC	1 cut(s)	112
PfeI	GAWTC	3 cut(s)	4, 216, 345
PflMI	CCANNNNNTGG	1 cut(s)	141
PkrI	GCNGC	2 cut(s)	225, 303
PleI	GAGTC	1 cut(s)	420
PpsI	GAGTC	1 cut(s)	420
Psp6I	CCWGG	2 cut(s)	116, 150
PspGI	CCWGG	2 cut(s)	116, 150
PspN4I	GGNNCC	2 cut(s)	162, 360
PspPI	GGNCC	3 cut(s)	359, 379, 449
PsuI	RGATCY	1 cut(s)	307
RsaI	GTAC	1 cut(s)	294
RsaNI	GTAC	1 cut(s)	293
Rsr2I	CGGWCCG	1 cut(s)	449
RsrII	CGGWCCG	1 cut(s)	449
SaqAI	TTAA	2 cut(s)	297, 318
SatI	GCNGC	2 cut(s)	224, 302
Sau3AI	GATC	1 cut(s)	307
Sau96I	GGNCC	3 cut(s)	359, 379, 449
SchI	GAGTC	1 cut(s)	420
ScrFI	CCNGG	2 cut(s)	118, 152
SetI	ASST	9 cut(s)	29, 35, 45, 108, 162, 228, 237, 303, 333
SfaNI	GCATC	1 cut(s)	107
SinI	GGWCC	2 cut(s)	359, 449
SmlI	CTYRAG	2 cut(s)	296, 317
SmoI	CTYRAG	2 cut(s)	296, 317
Sse9I	AATT	1 cut(s)	202
SseBI	AGGCCT	1 cut(s)	121
SsiI	CCGC	3 cut(s)	76, 91, 356
SspMI	CTAG	1 cut(s)	107
StuI	AGGCCT	1 cut(s)	121
StyD4I	CCNGG	2 cut(s)	116, 150
TaaI	ACNGT	3 cut(s)	193, 199, 453
TaqI	TCGA	1 cut(s)	206
TaqII	GACCGA	1 cut(s)	376
TasI	AATT	1 cut(s)	202
TfiI	GAWTC	3 cut(s)	4, 216, 345
Tru1I	TTAA	2 cut(s)	297, 318
Tru9I	TTAA	2 cut(s)	297, 318
TscAI	CASTG	2 cut(s)	202, 411
TseFI	GTSAC	1 cut(s)	193
TseI	GCWGC	2 cut(s)	223, 301
Tsp45I	GTSAC	1 cut(s)	193
TspDTI	ATGAA	2 cut(s)	17, 233
TspRI	CASTG	2 cut(s)	202, 411
Van91I	CCANNNNNTGG	1 cut(s)	141
Vha464I	CTTAAG	2 cut(s)	296, 317
VpaK11BI	GGWCC	2 cut(s)	359, 449
XapI	RAATTY	1 cut(s)	202
XceI	RCATGY	1 cut(s)	277
XspI	CTAG	1 cut(s)	107

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.