Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00001654

Orthogroup ID

OG0001252

Physical Location & Seq

Genomic Coordinates Forward (+)

2722 .. 3214

Gene Structure 493 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom1654g00010.2

Sequence Viewer

CDS Protein Promoter (2k)

Length: 441 bp

ATGTGGAGAAAGGTGGAGCTTCACAAAGGTTGTTTGCGTGAAGCCCCACTACGAGGCCGGAAGCCATCGGAGCGGGAGGCATCGGAGCTAGAGCATTCCAAGCCTCAATACTTGGCCAAGCGCTGGATGACCAGGAAAAAGGTGCCTCTGGAGATAAGACGCAAGCCTTTGACGGTCACTGTGAATTCGACCCTCAGATTCTTGCAGCTCATCAAGCTTCTTCTTCATCCCCGACGAATAGTTATTTGCAAGCACATGCAAACTTCTATTCTCGTACTTAAGCTGCTGGATCTCTTGCTTAAGTCTTTCCACCTCTGCCATCAACGATTCCACTTGGCGGGACCGAGCAAGCAGGCGTTGGCCCATGTTGGACACAGAACTCGCACACTGAACACTAAGTGCGAGGGACTCTTGAACGGCCAACTCATCGGACCGTCCTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005783 GO:0005789 GO:0008150 GO:0008152 GO:0012505 GO:0016020 GO:0016491 GO:0016705 GO:0031984 GO:0042175 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044425 GO:0044432 GO:0044444 GO:0044446 GO:0044464 GO:0045485 GO:0055114 GO:0098827

KEGG Pathways

Metabolic & Signaling

ko01040 ko01212 map01040 map01212

Pfam Domains

Protein Families

DUF3474 FA_desaturase

Protein Analysis

147

Amino Acids

16.97

Weight (kDa)

11.01

Isoelectric Point (pI)

38.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001252)

Species	Orthologous Gene IDs
pyrus_communis	pycom02g19100 pycom02g22930 pycom03g11160 pycom05g06380 pycom06g01440 pycom07g08770 pycom07g09280 pycom07g09480 pycom07g10240 pycom07g11270 pycom07g11980 pycom09g14200 pycom09g15110 pycom09g15730 pycom11g16170 pycom123g00010 pycom12429g00040 pycom1242g00140 pycom12438g00050 pycom12439g00010 pycom12457g00010 pycom12459g00040 pycom12460g00010 pycom12460g00040 pycom12468g00040 pycom12499g00020 pycom12499g00040 pycom12552g00050 pycom12556g00080 pycom12663g00010 pycom12678g00020 pycom1317g00010 pycom13g25440 pycom14g08150 pycom15g28910 pycom15g30880 pycom15g33340 pycom1654g00010 pycom16g17750 pycom16g22070 pycom16g24740 pycom17g09970 pycom1844g00140 pycom1958g00040 pycom2217g00030 pycom2309g00040 pycom2339g00090 pycom2595g00010 pycom2951g00010 pycom439g00050 pycom476g00040 pycom516g00010 pycom520g00230 pycom520g00720 pycom723g00020 pycom775g00030

Species

Orthologous Gene IDs

pyrus_communis

pycom02g19100 pycom02g22930 pycom03g11160 pycom05g06380 pycom06g01440 pycom07g08770 pycom07g09280 pycom07g09480 pycom07g10240 pycom07g11270 pycom07g11980 pycom09g14200 pycom09g15110 pycom09g15730 pycom11g16170 pycom123g00010 pycom12429g00040 pycom1242g00140 pycom12438g00050 pycom12439g00010 pycom12457g00010 pycom12459g00040 pycom12460g00010 pycom12460g00040 pycom12468g00040 pycom12499g00020 pycom12499g00040 pycom12552g00050 pycom12556g00080 pycom12663g00010 pycom12678g00020 pycom1317g00010 pycom13g25440 pycom14g08150 pycom15g28910 pycom15g30880 pycom15g33340 pycom1654g00010 pycom16g17750 pycom16g22070 pycom16g24740 pycom17g09970 pycom1844g00140 pycom1958g00040 pycom2217g00030 pycom2309g00040 pycom2339g00090 pycom2595g00010 pycom2951g00010 pycom439g00050 pycom476g00040 pycom516g00010 pycom520g00230 pycom520g00720 pycom723g00020 pycom775g00030

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	142
AccB7I	CCANNNNNTGG	1 cut(s)	123
AccBSI	CCGCTC	1 cut(s)	73
AciI	CCGC	2 cut(s)	73, 338
AclWI	GGATC	1 cut(s)	297
AcoI	YGGCCR	2 cut(s)	114, 418
AcsI	RAATTY	1 cut(s)	184
AdeI	CACNNNGTG	1 cut(s)	399
AfaI	GTAC	1 cut(s)	276
AfeI	AGCGCT	1 cut(s)	122
AfiI	CCNNNNNNNGG	3 cut(s)	53, 123, 337
AflII	CTTAAG	2 cut(s)	278, 299
AgsI	TTSAA	1 cut(s)	415
AjnI	CCWGG	1 cut(s)	131
AluBI	AGCT	5 cut(s)	19, 88, 208, 217, 283
AluI	AGCT	5 cut(s)	19, 88, 208, 217, 283
AlwI	GGATC	1 cut(s)	297
Aor51HI	AGCGCT	1 cut(s)	122
AoxI	GGCC	4 cut(s)	55, 114, 360, 418
ApeKI	GCWGC	2 cut(s)	205, 283
ApoI	RAATTY	1 cut(s)	184
AspLEI	GCGC	1 cut(s)	123
AspS9I	GGNCC	3 cut(s)	341, 361, 431
AvaII	GGWCC	2 cut(s)	341, 431
BalI	TGGCCA	1 cut(s)	116
BanI	GGYRCC	1 cut(s)	142
BarI	GAAGNNNNNNTAC	2 cut(s)	33, 65
BbvI	GCAGC	2 cut(s)	217, 270
BccI	CCATC	2 cut(s)	73, 327
BceAI	ACGGC	1 cut(s)	433
BciT130I	CCWGG	1 cut(s)	133
BfaI	CTAG	1 cut(s)	89
BfoI	RGCGCY	1 cut(s)	124
BfrI	CTTAAG	2 cut(s)	278, 299
BisI	GCNGC	2 cut(s)	206, 284
BlsI	GCNGC	2 cut(s)	207, 285
Bme1390I	CCNGG	1 cut(s)	133
Bme18I	GGWCC	2 cut(s)	341, 431
BmgT120I	GGNCC	3 cut(s)	341, 361, 431
BmiI	GGNNCC	2 cut(s)	144, 342
BmrFI	CCNGG	1 cut(s)	133
BmsI	GCATC	1 cut(s)	89
BpmI	CTGGAG	1 cut(s)	170
Bsc4I	CCNNNNNNNGG	3 cut(s)	53, 123, 337
BseBI	CCWGG	1 cut(s)	133
BseGI	GGATG	2 cut(s)	132, 226
BseLI	CCNNNNNNNGG	3 cut(s)	53, 123, 337
BseMII	CTCAG	1 cut(s)	208
BseXI	GCAGC	2 cut(s)	217, 270
BshFI	GGCC	4 cut(s)	57, 116, 362, 420
BshNI	GGYRCC	1 cut(s)	142
BsiSI	CCGG	1 cut(s)	58
BslFI	GGGAC	2 cut(s)	354, 420
BslI	CCNNNNNNNGG	3 cut(s)	53, 123, 337
BsmFI	GGGAC	2 cut(s)	354, 420
BsmI	GAATGC	1 cut(s)	94
BsnI	GGCC	4 cut(s)	57, 116, 362, 420
Bsp143I	GATC	1 cut(s)	289
BspACI	CCGC	2 cut(s)	73, 338
BspANI	GGCC	4 cut(s)	57, 116, 362, 420
BspCNI	CTCAG	1 cut(s)	207
BspLI	GGNNCC	2 cut(s)	144, 342
BspPI	GGATC	1 cut(s)	297
BspT107I	GGYRCC	1 cut(s)	142
BspTI	CTTAAG	2 cut(s)	278, 299
BsrBI	CCGCTC	1 cut(s)	73
BssMI	GATC	1 cut(s)	289
Bst2UI	CCWGG	1 cut(s)	133
Bst4CI	ACNGT	3 cut(s)	175, 181, 435
BstAFI	CTTAAG	2 cut(s)	278, 299
BstC8I	GCNNGC	4 cut(s)	164, 251, 350, 354
BstDEI	CTNAG	2 cut(s)	194, 396
BstF5I	GGATG	2 cut(s)	132, 226
BstH2I	RGCGCY	1 cut(s)	124
BstHHI	GCGC	1 cut(s)	123
BstKTI	GATC	1 cut(s)	292
BstMBI	GATC	1 cut(s)	289
BstMWI	GCNNNNNNNGC	3 cut(s)	70, 100, 214
BstNI	CCWGG	1 cut(s)	133
BstNSI	RCATGY	1 cut(s)	259
BstSCI	CCNGG	1 cut(s)	131
BstV1I	GCAGC	2 cut(s)	217, 270
BstX2I	RGATCY	1 cut(s)	289
BstYI	RGATCY	1 cut(s)	289
BsuRI	GGCC	4 cut(s)	57, 116, 362, 420
BtsCI	GGATG	2 cut(s)	132, 226
BtsIMutI	CAGTG	2 cut(s)	177, 386
Cac8I	GCNNGC	4 cut(s)	164, 251, 350, 354
CfoI	GCGC	1 cut(s)	123
Cfr13I	GGNCC	3 cut(s)	341, 361, 431
CpoI	CGGWCCG	1 cut(s)	431
CseI	GACGC	1 cut(s)	168
Csp6I	GTAC	1 cut(s)	275
CspI	CGGWCCG	1 cut(s)	431
CviAII	CATG	2 cut(s)	256, 365
CviQI	GTAC	1 cut(s)	275
DdeI	CTNAG	2 cut(s)	194, 396
DpnI	GATC	1 cut(s)	291
DpnII	GATC	1 cut(s)	289
DraIII	CACNNNGTG	1 cut(s)	399
EaeI	YGGCCR	2 cut(s)	114, 418
Eco47I	GGWCC	2 cut(s)	341, 431
Eco47III	AGCGCT	1 cut(s)	122
EcoRI	GAATTC	1 cut(s)	184
EcoRII	CCWGG	1 cut(s)	131
FaeI	CATG	2 cut(s)	259, 368
FaiI	YATR	2 cut(s)	257, 366
FaqI	GGGAC	2 cut(s)	354, 420
FatI	CATG	2 cut(s)	255, 364
FauI	CCCGC	2 cut(s)	66, 331
Fnu4HI	GCNGC	2 cut(s)	206, 284
FokI	GGATG	2 cut(s)	139, 213
Fsp4HI	GCNGC	2 cut(s)	206, 284
FspBI	CTAG	1 cut(s)	89
GlaI	GCGC	1 cut(s)	122
GluI	GCNGC	2 cut(s)	206, 284
GsuI	CTGGAG	1 cut(s)	170
HaeII	RGCGCY	1 cut(s)	124
HaeIII	GGCC	4 cut(s)	57, 116, 362, 420
HapII	CCGG	1 cut(s)	58
HgaI	GACGC	1 cut(s)	168
HhaI	GCGC	1 cut(s)	123
Hin1II	CATG	2 cut(s)	259, 368
Hin6I	GCGC	1 cut(s)	121
HinP1I	GCGC	1 cut(s)	121
HindIII	AAGCTT	1 cut(s)	215
HinfI	GANTC	3 cut(s)	198, 327, 408
HpaII	CCGG	1 cut(s)	58
Hpy188I	TCNGA	4 cut(s)	70, 85, 197, 431
Hpy188III	TCNNGA	3 cut(s)	149, 412, 438
Hpy99I	CGWCG	1 cut(s)	237
HpyCH4III	ACNGT	3 cut(s)	175, 181, 435
HpyCH4V	TGCA	3 cut(s)	205, 249, 259
HpyF10VI	GCNNNNNNNGC	3 cut(s)	70, 100, 214
HpyF3I	CTNAG	2 cut(s)	194, 396
Hsp92II	CATG	2 cut(s)	259, 368
HspAI	GCGC	1 cut(s)	121
Kzo9I	GATC	1 cut(s)	289
LmnI	GCTCC	3 cut(s)	16, 70, 85
LpnPI	CCDG	7 cut(s)	71, 109, 118, 134, 145, 272, 338
Lsp1109I	GCAGC	2 cut(s)	217, 270
LweI	GCATC	1 cut(s)	89
MaeI	CTAG	1 cut(s)	89
MaeIII	GTNAC	1 cut(s)	175
MalI	GATC	1 cut(s)	291
MbiI	CCGCTC	1 cut(s)	73
MboI	GATC	1 cut(s)	289
MboII	GAAGA	2 cut(s)	212, 215
MflI	RGATCY	1 cut(s)	289
MlsI	TGGCCA	1 cut(s)	116
MluCI	AATT	1 cut(s)	184
MluNI	TGGCCA	1 cut(s)	116
MlyI	GAGTC	1 cut(s)	402
MmeI	TCCRAC	1 cut(s)	349
MnlI	CCTC	7 cut(s)	47, 70, 114, 156, 203, 323, 397
Mox20I	TGGCCA	1 cut(s)	116
MscI	TGGCCA	1 cut(s)	116
MseI	TTAA	2 cut(s)	279, 300
Msp20I	TGGCCA	1 cut(s)	116
MspCI	CTTAAG	2 cut(s)	278, 299
MspI	CCGG	1 cut(s)	58
MspR9I	CCNGG	1 cut(s)	133
Mva1269I	GAATGC	1 cut(s)	94
MvaI	CCWGG	1 cut(s)	133
MwoI	GCNNNNNNNGC	3 cut(s)	70, 100, 214
NdeII	GATC	1 cut(s)	289
NlaIII	CATG	2 cut(s)	259, 368
NlaIV	GGNNCC	2 cut(s)	144, 342
NmuCI	GTSAC	1 cut(s)	175
NspI	RCATGY	1 cut(s)	259
PctI	GAATGC	1 cut(s)	94
PfeI	GAWTC	2 cut(s)	198, 327
PflMI	CCANNNNNTGG	1 cut(s)	123
PkrI	GCNGC	2 cut(s)	207, 285
PleI	GAGTC	1 cut(s)	402
PpsI	GAGTC	1 cut(s)	402
Psp6I	CCWGG	1 cut(s)	131
PspGI	CCWGG	1 cut(s)	131
PspN4I	GGNNCC	2 cut(s)	144, 342
PspPI	GGNCC	3 cut(s)	341, 361, 431
PsuI	RGATCY	1 cut(s)	289
RsaI	GTAC	1 cut(s)	276
RsaNI	GTAC	1 cut(s)	275
Rsr2I	CGGWCCG	1 cut(s)	431
RsrII	CGGWCCG	1 cut(s)	431
SaqAI	TTAA	2 cut(s)	279, 300
SatI	GCNGC	2 cut(s)	206, 284
Sau3AI	GATC	1 cut(s)	289
Sau96I	GGNCC	3 cut(s)	341, 361, 431
SchI	GAGTC	1 cut(s)	402
ScrFI	CCNGG	1 cut(s)	133
SetI	ASST	9 cut(s)	15, 21, 31, 90, 144, 210, 219, 285, 315
SfaNI	GCATC	1 cut(s)	89
SinI	GGWCC	2 cut(s)	341, 431
SmlI	CTYRAG	2 cut(s)	278, 299
SmoI	CTYRAG	2 cut(s)	278, 299
Sse9I	AATT	1 cut(s)	184
SsiI	CCGC	2 cut(s)	73, 338
SspMI	CTAG	1 cut(s)	89
StyD4I	CCNGG	1 cut(s)	131
TaaI	ACNGT	3 cut(s)	175, 181, 435
TaqI	TCGA	1 cut(s)	188
TaqII	GACCGA	1 cut(s)	358
TasI	AATT	1 cut(s)	184
TfiI	GAWTC	2 cut(s)	198, 327
Tru1I	TTAA	2 cut(s)	279, 300
Tru9I	TTAA	2 cut(s)	279, 300
TscAI	CASTG	2 cut(s)	184, 393
TseFI	GTSAC	1 cut(s)	175
TseI	GCWGC	2 cut(s)	205, 283
Tsp45I	GTSAC	1 cut(s)	175
TspDTI	ATGAA	1 cut(s)	215
TspRI	CASTG	2 cut(s)	184, 393
Van91I	CCANNNNNTGG	1 cut(s)	123
Vha464I	CTTAAG	2 cut(s)	278, 299
VpaK11BI	GGWCC	2 cut(s)	341, 431
XapI	RAATTY	1 cut(s)	184
XceI	RCATGY	1 cut(s)	259
XspI	CTAG	1 cut(s)	89

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.