Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00012499

Orthogroup ID

OG0001252

Physical Location & Seq

Genomic Coordinates Reverse (-)

87102 .. 87287

Gene Structure 186 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom12499g00040.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 186 bp

ATGCAAACTTCTATTCTCGTACTTAAGCTGCTGGATCTCTTGCTTAAGACTTTCCACCTCTGCCATCAAAGATTCCACCTGACGGGAGCGGGCAAGCAGGCGTTGGCCCATGTTGGACACAGAGCTCGCACACTGAACACTAAGAGCGAGGGATTCTTGAACGGCCAACTCATCGGACCGTCCTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005783 GO:0005789 GO:0008150 GO:0008152 GO:0012505 GO:0016020 GO:0016491 GO:0016705 GO:0031984 GO:0042175 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044425 GO:0044432 GO:0044444 GO:0044446 GO:0044464 GO:0045485 GO:0055114 GO:0098827

KEGG Pathways

Metabolic & Signaling

ko01040 ko01212 map01040 map01212

Pfam Domains

Protein Families

DUF3474 FA_desaturase

Protein Analysis

62

Amino Acids

6.73

Weight (kDa)

10.45

Isoelectric Point (pI)

14.32

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001252)

Species	Orthologous Gene IDs
pyrus_communis	pycom02g19100 pycom02g22930 pycom03g11160 pycom05g06380 pycom06g01440 pycom07g08770 pycom07g09280 pycom07g09480 pycom07g10240 pycom07g11270 pycom07g11980 pycom09g14200 pycom09g15110 pycom09g15730 pycom11g16170 pycom123g00010 pycom12429g00040 pycom1242g00140 pycom12438g00050 pycom12439g00010 pycom12457g00010 pycom12459g00040 pycom12460g00010 pycom12460g00040 pycom12468g00040 pycom12499g00020 pycom12499g00040 pycom12552g00050 pycom12556g00080 pycom12663g00010 pycom12678g00020 pycom1317g00010 pycom13g25440 pycom14g08150 pycom15g28910 pycom15g30880 pycom15g33340 pycom1654g00010 pycom16g17750 pycom16g22070 pycom16g24740 pycom17g09970 pycom1844g00140 pycom1958g00040 pycom2217g00030 pycom2309g00040 pycom2339g00090 pycom2595g00010 pycom2951g00010 pycom439g00050 pycom476g00040 pycom516g00010 pycom520g00230 pycom520g00720 pycom723g00020 pycom775g00030

Species

Orthologous Gene IDs

pyrus_communis

pycom02g19100 pycom02g22930 pycom03g11160 pycom05g06380 pycom06g01440 pycom07g08770 pycom07g09280 pycom07g09480 pycom07g10240 pycom07g11270 pycom07g11980 pycom09g14200 pycom09g15110 pycom09g15730 pycom11g16170 pycom123g00010 pycom12429g00040 pycom1242g00140 pycom12438g00050 pycom12439g00010 pycom12457g00010 pycom12459g00040 pycom12460g00010 pycom12460g00040 pycom12468g00040 pycom12499g00020 pycom12499g00040 pycom12552g00050 pycom12556g00080 pycom12663g00010 pycom12678g00020 pycom1317g00010 pycom13g25440 pycom14g08150 pycom15g28910 pycom15g30880 pycom15g33340 pycom1654g00010 pycom16g17750 pycom16g22070 pycom16g24740 pycom17g09970 pycom1844g00140 pycom1958g00040 pycom2217g00030 pycom2309g00040 pycom2339g00090 pycom2595g00010 pycom2951g00010 pycom439g00050 pycom476g00040 pycom516g00010 pycom520g00230 pycom520g00720 pycom723g00020 pycom775g00030

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	89
AciI	CCGC	1 cut(s)	89
AclWI	GGATC	1 cut(s)	42
AcoI	YGGCCR	1 cut(s)	163
AfaI	GTAC	1 cut(s)	21
AfiI	CCNNNNNNNGG	1 cut(s)	82
AflII	CTTAAG	2 cut(s)	23, 44
AgsI	TTSAA	1 cut(s)	160
AluBI	AGCT	2 cut(s)	28, 125
AluI	AGCT	2 cut(s)	28, 125
Alw21I	GWGCWC	1 cut(s)	127
AlwI	GGATC	1 cut(s)	42
AoxI	GGCC	2 cut(s)	105, 163
ApeKI	GCWGC	1 cut(s)	28
AspS9I	GGNCC	2 cut(s)	106, 176
AvaII	GGWCC	1 cut(s)	176
BanII	GRGCYC	1 cut(s)	127
Bbv12I	GWGCWC	1 cut(s)	127
BbvI	GCAGC	1 cut(s)	15
BccI	CCATC	1 cut(s)	72
BceAI	ACGGC	1 cut(s)	178
BfrI	CTTAAG	2 cut(s)	23, 44
BisI	GCNGC	1 cut(s)	29
BlsI	GCNGC	1 cut(s)	30
Bme18I	GGWCC	1 cut(s)	176
BmgT120I	GGNCC	2 cut(s)	106, 176
Bsc4I	CCNNNNNNNGG	1 cut(s)	82
BseLI	CCNNNNNNNGG	1 cut(s)	82
BseXI	GCAGC	1 cut(s)	15
BshFI	GGCC	2 cut(s)	107, 165
BsiHKAI	GWGCWC	1 cut(s)	127
BslI	CCNNNNNNNGG	1 cut(s)	82
BsnI	GGCC	2 cut(s)	107, 165
Bsp1286I	GDGCHC	1 cut(s)	127
Bsp143I	GATC	1 cut(s)	34
BspACI	CCGC	1 cut(s)	89
BspANI	GGCC	2 cut(s)	107, 165
BspPI	GGATC	1 cut(s)	42
BspTI	CTTAAG	2 cut(s)	23, 44
BsrBI	CCGCTC	1 cut(s)	89
BssMI	GATC	1 cut(s)	34
Bst4CI	ACNGT	1 cut(s)	180
BstAFI	CTTAAG	2 cut(s)	23, 44
BstC8I	GCNNGC	4 cut(s)	91, 95, 99, 127
BstDEI	CTNAG	1 cut(s)	141
BstKTI	GATC	1 cut(s)	37
BstMBI	GATC	1 cut(s)	34
BstV1I	GCAGC	1 cut(s)	15
BstX2I	RGATCY	1 cut(s)	34
BstYI	RGATCY	1 cut(s)	34
BsuRI	GGCC	2 cut(s)	107, 165
BtsIMutI	CAGTG	1 cut(s)	131
Cac8I	GCNNGC	4 cut(s)	91, 95, 99, 127
Cfr13I	GGNCC	2 cut(s)	106, 176
CpoI	CGGWCCG	1 cut(s)	176
Csp6I	GTAC	1 cut(s)	20
CspI	CGGWCCG	1 cut(s)	176
CviAII	CATG	1 cut(s)	110
CviJI	RGCY	4 cut(s)	28, 107, 125, 165
CviKI_1	RGCY	4 cut(s)	28, 107, 125, 165
CviQI	GTAC	1 cut(s)	20
DdeI	CTNAG	1 cut(s)	141
DpnI	GATC	1 cut(s)	36
DpnII	GATC	1 cut(s)	34
EaeI	YGGCCR	1 cut(s)	163
Ecl136II	GAGCTC	1 cut(s)	125
Eco24I	GRGCYC	1 cut(s)	127
Eco47I	GGWCC	1 cut(s)	176
Eco53kI	GAGCTC	1 cut(s)	125
EcoICRI	GAGCTC	1 cut(s)	125
EcoT38I	GRGCYC	1 cut(s)	127
FaeI	CATG	1 cut(s)	113
FaiI	YATR	1 cut(s)	111
FatI	CATG	1 cut(s)	109
FauI	CCCGC	1 cut(s)	82
Fnu4HI	GCNGC	1 cut(s)	29
FriOI	GRGCYC	1 cut(s)	127
Fsp4HI	GCNGC	1 cut(s)	29
GluI	GCNGC	1 cut(s)	29
HaeIII	GGCC	2 cut(s)	107, 165
Hin1II	CATG	1 cut(s)	113
HinfI	GANTC	2 cut(s)	72, 153
Hpy188I	TCNGA	1 cut(s)	176
Hpy188III	TCNNGA	2 cut(s)	157, 183
HpyCH4III	ACNGT	1 cut(s)	180
HpyCH4V	TGCA	1 cut(s)	4
HpyF3I	CTNAG	1 cut(s)	141
Hsp92II	CATG	1 cut(s)	113
Kzo9I	GATC	1 cut(s)	34
LmnI	GCTCC	1 cut(s)	86
LpnPI	CCDG	3 cut(s)	17, 83, 92
Lsp1109I	GCAGC	1 cut(s)	15
MalI	GATC	1 cut(s)	36
MbiI	CCGCTC	1 cut(s)	89
MboI	GATC	1 cut(s)	34
MflI	RGATCY	1 cut(s)	34
MhlI	GDGCHC	1 cut(s)	127
MmeI	TCCRAC	1 cut(s)	94
MnlI	CCTC	2 cut(s)	68, 142
MseI	TTAA	2 cut(s)	24, 45
MspCI	CTTAAG	2 cut(s)	23, 44
NdeII	GATC	1 cut(s)	34
NlaIII	CATG	1 cut(s)	113
PfeI	GAWTC	2 cut(s)	72, 153
PkrI	GCNGC	1 cut(s)	30
Psp124BI	GAGCTC	1 cut(s)	127
PspPI	GGNCC	2 cut(s)	106, 176
PsuI	RGATCY	1 cut(s)	34
RsaI	GTAC	1 cut(s)	21
RsaNI	GTAC	1 cut(s)	20
Rsr2I	CGGWCCG	1 cut(s)	176
RsrII	CGGWCCG	1 cut(s)	176
SacI	GAGCTC	1 cut(s)	127
SaqAI	TTAA	2 cut(s)	24, 45
SatI	GCNGC	1 cut(s)	29
Sau3AI	GATC	1 cut(s)	34
Sau96I	GGNCC	2 cut(s)	106, 176
SduI	GDGCHC	1 cut(s)	127
SetI	ASST	4 cut(s)	30, 60, 81, 127
SinI	GGWCC	1 cut(s)	176
SmlI	CTYRAG	2 cut(s)	23, 44
SmoI	CTYRAG	2 cut(s)	23, 44
SsiI	CCGC	1 cut(s)	89
SstI	GAGCTC	1 cut(s)	127
TaaI	ACNGT	1 cut(s)	180
TfiI	GAWTC	2 cut(s)	72, 153
Tru1I	TTAA	2 cut(s)	24, 45
Tru9I	TTAA	2 cut(s)	24, 45
TscAI	CASTG	1 cut(s)	138
TseI	GCWGC	1 cut(s)	28
TspRI	CASTG	1 cut(s)	138
Vha464I	CTTAAG	2 cut(s)	23, 44
VpaK11BI	GGWCC	1 cut(s)	176

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.