Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00012457

Orthogroup ID

OG0001252

Physical Location & Seq

Genomic Coordinates Reverse (-)

3470 .. 4066

Gene Structure 597 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom12457g00010.2

Sequence Viewer

CDS Protein Promoter (2k)

Length: 465 bp

ATGCCGTTTGATTTTATTTATACTAAACATGGAGAAAGGTGGAGCTTCACAAAGGTTGTTTGCGTGAAGCCCACTACGAGGCCGGAAGCCATCGAAGCGGGAGGCATCGGAGCTAGAGCATTCCAGGCCTCAATACTTGGCAAGCGCTGGATGACCCAGGAAAAAGGTGCCTCTGGAGATAAGACGCAAGCCTTTGACGGTCACTGTGAATTCGACCCTCAGATTCTTGCAGCTCATCAGCTTCCTCTTCATCCCCGACGAATAGTTATTTGCAAGCACATGCAAACTTCTATTCTCGTACTTAAGCTGCTGGATCTCTTGCTTAAGTCTTTCCACCTCTGCCATCAACGATTCCACTTGGCGGGACCGAGCAAGCAAGCGTTGGCCCATGTTGGACACAGAACTCGCACACTGAACACTAAGTGCGAGGGACTCTTGAACGGCCAACTCATCGGACCGTCCTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005783 GO:0005789 GO:0008150 GO:0008152 GO:0012505 GO:0016020 GO:0016491 GO:0016705 GO:0031984 GO:0042175 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044425 GO:0044432 GO:0044444 GO:0044446 GO:0044464 GO:0045485 GO:0055114 GO:0098827

KEGG Pathways

Metabolic & Signaling

ko01040 ko01212 map01040 map01212

Pfam Domains

Protein Families

DUF3474 FA_desaturase

Protein Analysis

155

Amino Acids

17.2

Weight (kDa)

9.67

Isoelectric Point (pI)

36.0

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001252)

Species	Orthologous Gene IDs
pyrus_communis	pycom02g19100 pycom02g22930 pycom03g11160 pycom05g06380 pycom06g01440 pycom07g08770 pycom07g09280 pycom07g09480 pycom07g10240 pycom07g11270 pycom07g11980 pycom09g14200 pycom09g15110 pycom09g15730 pycom11g16170 pycom123g00010 pycom12429g00040 pycom1242g00140 pycom12438g00050 pycom12439g00010 pycom12457g00010 pycom12459g00040 pycom12460g00010 pycom12460g00040 pycom12468g00040 pycom12499g00020 pycom12499g00040 pycom12552g00050 pycom12556g00080 pycom12663g00010 pycom12678g00020 pycom1317g00010 pycom13g25440 pycom14g08150 pycom15g28910 pycom15g30880 pycom15g33340 pycom1654g00010 pycom16g17750 pycom16g22070 pycom16g24740 pycom17g09970 pycom1844g00140 pycom1958g00040 pycom2217g00030 pycom2309g00040 pycom2339g00090 pycom2595g00010 pycom2951g00010 pycom439g00050 pycom476g00040 pycom516g00010 pycom520g00230 pycom520g00720 pycom723g00020 pycom775g00030

Species

Orthologous Gene IDs

pyrus_communis

pycom02g19100 pycom02g22930 pycom03g11160 pycom05g06380 pycom06g01440 pycom07g08770 pycom07g09280 pycom07g09480 pycom07g10240 pycom07g11270 pycom07g11980 pycom09g14200 pycom09g15110 pycom09g15730 pycom11g16170 pycom123g00010 pycom12429g00040 pycom1242g00140 pycom12438g00050 pycom12439g00010 pycom12457g00010 pycom12459g00040 pycom12460g00010 pycom12460g00040 pycom12468g00040 pycom12499g00020 pycom12499g00040 pycom12552g00050 pycom12556g00080 pycom12663g00010 pycom12678g00020 pycom1317g00010 pycom13g25440 pycom14g08150 pycom15g28910 pycom15g30880 pycom15g33340 pycom1654g00010 pycom16g17750 pycom16g22070 pycom16g24740 pycom17g09970 pycom1844g00140 pycom1958g00040 pycom2217g00030 pycom2309g00040 pycom2339g00090 pycom2595g00010 pycom2951g00010 pycom439g00050 pycom476g00040 pycom516g00010 pycom520g00230 pycom520g00720 pycom723g00020 pycom775g00030

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	167
AciI	CCGC	2 cut(s)	98, 362
AclWI	GGATC	1 cut(s)	321
AcoI	YGGCCR	1 cut(s)	442
AcsI	RAATTY	1 cut(s)	209
AdeI	CACNNNGTG	1 cut(s)	423
AfaI	GTAC	1 cut(s)	300
AfeI	AGCGCT	1 cut(s)	146
AfiI	CCNNNNNNNGG	2 cut(s)	78, 361
AflII	CTTAAG	2 cut(s)	302, 323
AgsI	TTSAA	1 cut(s)	439
AjnI	CCWGG	2 cut(s)	123, 156
AluBI	AGCT	5 cut(s)	45, 113, 233, 241, 307
AluI	AGCT	5 cut(s)	45, 113, 233, 241, 307
AlwI	GGATC	1 cut(s)	321
Aor51HI	AGCGCT	1 cut(s)	146
AoxI	GGCC	4 cut(s)	80, 126, 384, 442
ApeKI	GCWGC	2 cut(s)	230, 307
ApoI	RAATTY	1 cut(s)	209
AspLEI	GCGC	1 cut(s)	147
AspS9I	GGNCC	3 cut(s)	365, 385, 455
AvaII	GGWCC	2 cut(s)	365, 455
BanI	GGYRCC	1 cut(s)	167
BbvI	GCAGC	2 cut(s)	242, 294
BccI	CCATC	2 cut(s)	98, 351
BceAI	ACGGC	1 cut(s)	457
BciT130I	CCWGG	2 cut(s)	125, 158
BfaI	CTAG	1 cut(s)	114
BfoI	RGCGCY	1 cut(s)	148
BfrI	CTTAAG	2 cut(s)	302, 323
BisI	GCNGC	2 cut(s)	231, 308
BlsI	GCNGC	2 cut(s)	232, 309
Bme1390I	CCNGG	2 cut(s)	125, 158
Bme18I	GGWCC	2 cut(s)	365, 455
BmgT120I	GGNCC	3 cut(s)	365, 385, 455
BmiI	GGNNCC	2 cut(s)	169, 366
BmrFI	CCNGG	2 cut(s)	125, 158
BmsI	GCATC	1 cut(s)	114
BpmI	CTGGAG	1 cut(s)	195
BsaJI	CCNNGG	1 cut(s)	156
Bsc4I	CCNNNNNNNGG	2 cut(s)	78, 361
BseBI	CCWGG	2 cut(s)	125, 158
BseDI	CCNNGG	1 cut(s)	156
BseGI	GGATG	2 cut(s)	156, 250
BseLI	CCNNNNNNNGG	2 cut(s)	78, 361
BseMII	CTCAG	1 cut(s)	233
BseXI	GCAGC	2 cut(s)	242, 294
BshFI	GGCC	4 cut(s)	82, 128, 386, 444
BshNI	GGYRCC	1 cut(s)	167
BsiSI	CCGG	1 cut(s)	83
BslFI	GGGAC	2 cut(s)	378, 444
BslI	CCNNNNNNNGG	2 cut(s)	78, 361
BsmFI	GGGAC	2 cut(s)	378, 444
BsmI	GAATGC	1 cut(s)	119
BsnI	GGCC	4 cut(s)	82, 128, 386, 444
Bsp143I	GATC	1 cut(s)	313
BspACI	CCGC	2 cut(s)	98, 362
BspANI	GGCC	4 cut(s)	82, 128, 386, 444
BspCNI	CTCAG	1 cut(s)	232
BspLI	GGNNCC	2 cut(s)	169, 366
BspPI	GGATC	1 cut(s)	321
BspT107I	GGYRCC	1 cut(s)	167
BspTI	CTTAAG	2 cut(s)	302, 323
BssECI	CCNNGG	1 cut(s)	156
BssMI	GATC	1 cut(s)	313
Bst2UI	CCWGG	2 cut(s)	125, 158
Bst4CI	ACNGT	3 cut(s)	200, 206, 459
Bst6I	CTCTTC	1 cut(s)	252
BstAFI	CTTAAG	2 cut(s)	302, 323
BstC8I	GCNNGC	5 cut(s)	143, 189, 275, 374, 378
BstDEI	CTNAG	2 cut(s)	219, 420
BstF5I	GGATG	2 cut(s)	156, 250
BstH2I	RGCGCY	1 cut(s)	148
BstHHI	GCGC	1 cut(s)	147
BstKTI	GATC	1 cut(s)	316
BstMBI	GATC	1 cut(s)	313
BstMWI	GCNNNNNNNGC	2 cut(s)	95, 125
BstNI	CCWGG	2 cut(s)	125, 158
BstNSI	RCATGY	1 cut(s)	283
BstSCI	CCNGG	2 cut(s)	123, 156
BstV1I	GCAGC	2 cut(s)	242, 294
BstX2I	RGATCY	1 cut(s)	313
BstYI	RGATCY	1 cut(s)	313
BsuRI	GGCC	4 cut(s)	82, 128, 386, 444
BtsCI	GGATG	2 cut(s)	156, 250
BtsIMutI	CAGTG	2 cut(s)	202, 410
Cac8I	GCNNGC	5 cut(s)	143, 189, 275, 374, 378
CfoI	GCGC	1 cut(s)	147
Cfr13I	GGNCC	3 cut(s)	365, 385, 455
CpoI	CGGWCCG	1 cut(s)	455
CseI	GACGC	1 cut(s)	193
Csp6I	GTAC	1 cut(s)	299
CspI	CGGWCCG	1 cut(s)	455
CviAII	CATG	3 cut(s)	29, 280, 389
CviQI	GTAC	1 cut(s)	299
DdeI	CTNAG	2 cut(s)	219, 420
DpnI	GATC	1 cut(s)	315
DpnII	GATC	1 cut(s)	313
DraIII	CACNNNGTG	1 cut(s)	423
EaeI	YGGCCR	1 cut(s)	442
Eam1104I	CTCTTC	1 cut(s)	252
EarI	CTCTTC	1 cut(s)	252
Eco147I	AGGCCT	1 cut(s)	128
Eco47I	GGWCC	2 cut(s)	365, 455
Eco47III	AGCGCT	1 cut(s)	146
EcoRI	GAATTC	1 cut(s)	209
EcoRII	CCWGG	2 cut(s)	123, 156
FaeI	CATG	3 cut(s)	32, 283, 392
FaiI	YATR	4 cut(s)	21, 30, 281, 390
FaqI	GGGAC	2 cut(s)	378, 444
FatI	CATG	3 cut(s)	28, 279, 388
FauI	CCCGC	2 cut(s)	91, 355
Fnu4HI	GCNGC	2 cut(s)	231, 308
FokI	GGATG	2 cut(s)	163, 237
Fsp4HI	GCNGC	2 cut(s)	231, 308
FspBI	CTAG	1 cut(s)	114
GlaI	GCGC	1 cut(s)	146
GluI	GCNGC	2 cut(s)	231, 308
GsuI	CTGGAG	1 cut(s)	195
HaeII	RGCGCY	1 cut(s)	148
HaeIII	GGCC	4 cut(s)	82, 128, 386, 444
HapII	CCGG	1 cut(s)	83
HgaI	GACGC	1 cut(s)	193
HhaI	GCGC	1 cut(s)	147
Hin1II	CATG	3 cut(s)	32, 283, 392
Hin6I	GCGC	1 cut(s)	145
HinP1I	GCGC	1 cut(s)	145
HinfI	GANTC	3 cut(s)	223, 351, 432
HpaII	CCGG	1 cut(s)	83
Hpy188I	TCNGA	3 cut(s)	110, 222, 455
Hpy188III	TCNNGA	3 cut(s)	174, 436, 462
Hpy99I	CGWCG	1 cut(s)	261
HpyCH4III	ACNGT	3 cut(s)	200, 206, 459
HpyCH4V	TGCA	3 cut(s)	230, 273, 283
HpyF10VI	GCNNNNNNNGC	2 cut(s)	95, 125
HpyF3I	CTNAG	2 cut(s)	219, 420
Hsp92II	CATG	3 cut(s)	32, 283, 392
HspAI	GCGC	1 cut(s)	145
Kzo9I	GATC	1 cut(s)	313
LmnI	GCTCC	2 cut(s)	42, 110
LpnPI	CCDG	8 cut(s)	96, 110, 133, 137, 143, 159, 170, 296
Lsp1109I	GCAGC	2 cut(s)	242, 294
LweI	GCATC	1 cut(s)	114
MaeI	CTAG	1 cut(s)	114
MaeIII	GTNAC	1 cut(s)	200
MalI	GATC	1 cut(s)	315
MboI	GATC	1 cut(s)	313
MboII	GAAGA	1 cut(s)	239
MflI	RGATCY	1 cut(s)	313
MluCI	AATT	1 cut(s)	209
MlyI	GAGTC	1 cut(s)	426
MmeI	TCCRAC	1 cut(s)	373
MnlI	CCTC	8 cut(s)	72, 95, 139, 181, 228, 255, 347, 421
MseI	TTAA	2 cut(s)	303, 324
MspCI	CTTAAG	2 cut(s)	302, 323
MspI	CCGG	1 cut(s)	83
MspR9I	CCNGG	2 cut(s)	125, 158
Mva1269I	GAATGC	1 cut(s)	119
MvaI	CCWGG	2 cut(s)	125, 158
MwoI	GCNNNNNNNGC	2 cut(s)	95, 125
NdeII	GATC	1 cut(s)	313
NlaIII	CATG	3 cut(s)	32, 283, 392
NlaIV	GGNNCC	2 cut(s)	169, 366
NmuCI	GTSAC	1 cut(s)	200
NspI	RCATGY	1 cut(s)	283
PceI	AGGCCT	1 cut(s)	128
PctI	GAATGC	1 cut(s)	119
PfeI	GAWTC	2 cut(s)	223, 351
PkrI	GCNGC	2 cut(s)	232, 309
PleI	GAGTC	1 cut(s)	426
PpsI	GAGTC	1 cut(s)	426
Psp6I	CCWGG	2 cut(s)	123, 156
PspGI	CCWGG	2 cut(s)	123, 156
PspN4I	GGNNCC	2 cut(s)	169, 366
PspPI	GGNCC	3 cut(s)	365, 385, 455
PsuI	RGATCY	1 cut(s)	313
RsaI	GTAC	1 cut(s)	300
RsaNI	GTAC	1 cut(s)	299
Rsr2I	CGGWCCG	1 cut(s)	455
RsrII	CGGWCCG	1 cut(s)	455
SaqAI	TTAA	2 cut(s)	303, 324
SatI	GCNGC	2 cut(s)	231, 308
Sau3AI	GATC	1 cut(s)	313
Sau96I	GGNCC	3 cut(s)	365, 385, 455
SchI	GAGTC	1 cut(s)	426
ScrFI	CCNGG	2 cut(s)	125, 158
SetI	ASST	9 cut(s)	41, 47, 57, 115, 169, 235, 243, 309, 339
SfaNI	GCATC	1 cut(s)	114
SinI	GGWCC	2 cut(s)	365, 455
SmlI	CTYRAG	2 cut(s)	302, 323
SmoI	CTYRAG	2 cut(s)	302, 323
Sse9I	AATT	1 cut(s)	209
SseBI	AGGCCT	1 cut(s)	128
SsiI	CCGC	2 cut(s)	98, 362
SspMI	CTAG	1 cut(s)	114
StuI	AGGCCT	1 cut(s)	128
StyD4I	CCNGG	2 cut(s)	123, 156
TaaI	ACNGT	3 cut(s)	200, 206, 459
TaqI	TCGA	2 cut(s)	93, 213
TaqII	GACCGA	1 cut(s)	382
TasI	AATT	1 cut(s)	209
TfiI	GAWTC	2 cut(s)	223, 351
Tru1I	TTAA	2 cut(s)	303, 324
Tru9I	TTAA	2 cut(s)	303, 324
TscAI	CASTG	2 cut(s)	209, 417
TseFI	GTSAC	1 cut(s)	200
TseI	GCWGC	2 cut(s)	230, 307
Tsp45I	GTSAC	1 cut(s)	200
TspDTI	ATGAA	1 cut(s)	239
TspRI	CASTG	2 cut(s)	209, 417
Vha464I	CTTAAG	2 cut(s)	302, 323
VpaK11BI	GGWCC	2 cut(s)	365, 455
XapI	RAATTY	1 cut(s)	209
XceI	RCATGY	1 cut(s)	283
XspI	CTAG	1 cut(s)	114

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.