pycom13g19970

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
15909494 .. 15909763
270 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 270 bp
ATGGATCGGTTTGGGTGGGGAGAAGCTATTTTTATACCACGTCAAGATTTCAGGGTCACATGCACCGGATCCTTGGGATGCGATCATACCAGCTCACATGCACCAGATCCCATCCGAACTCCGAAGTTAAATGAGTTGGGTGACCACCTGGGAAGTCCTTGTGTTGTATCTCCCCACAGCCGACCCCACTGGTGGGAAAAGGCTTTGTTGTGTTGTTGTTGTTGTTGTTGTTGTCAAGATTTCAGAGTCAAGTCTGTAGCCCACTACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.02

Weight (kDa)

6.96

Isoelectric Point (pI)

32.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 4 cut(s) 12, 63, 76, 101
AfiI CCNNNNNNNGG 2 cut(s) 192, 193
AjiI CACGTC 1 cut(s) 41
AjnI CCWGG 1 cut(s) 147
AluBI AGCT 2 cut(s) 26, 93
AluI AGCT 2 cut(s) 26, 93
AlwI GGATC 4 cut(s) 12, 63, 76, 101
AsuHPI GGTGA 1 cut(s) 152
BamHI GGATCC 1 cut(s) 68
BccI CCATC 1 cut(s) 119
BciT130I CCWGG 1 cut(s) 149
BfmI CTRYAG 1 cut(s) 255
Bme1390I CCNGG 1 cut(s) 149
BmgBI CACGTC 1 cut(s) 41
BmiI GGNNCC 1 cut(s) 70
BmrFI CCNGG 1 cut(s) 149
BmsI GCATC 1 cut(s) 68
BsaJI CCNNGG 2 cut(s) 72, 148
BsaWI WCCGGW 1 cut(s) 65
Bsc4I CCNNNNNNNGG 2 cut(s) 192, 193
Bse1I ACTGG 1 cut(s) 194
BseBI CCWGG 1 cut(s) 149
BseDI CCNNGG 2 cut(s) 72, 148
BseGI GGATG 2 cut(s) 83, 111
BseLI CCNNNNNNNGG 2 cut(s) 192, 193
BseNI ACTGG 1 cut(s) 194
BsiSI CCGG 1 cut(s) 66
BslI CCNNNNNNNGG 2 cut(s) 192, 193
Bsp143I GATC 4 cut(s) 4, 68, 82, 106
BspLI GGNNCC 1 cut(s) 70
BspPI GGATC 4 cut(s) 12, 63, 76, 101
BsrI ACTGG 1 cut(s) 194
BssECI CCNNGG 2 cut(s) 72, 148
BssMI GATC 4 cut(s) 4, 68, 82, 106
BssT1I CCWWGG 1 cut(s) 72
Bst2UI CCWGG 1 cut(s) 149
BstEII GGTNACC 1 cut(s) 140
BstF5I GGATG 2 cut(s) 83, 111
BstKTI GATC 4 cut(s) 7, 71, 85, 109
BstMBI GATC 4 cut(s) 4, 68, 82, 106
BstNI CCWGG 1 cut(s) 149
BstNSI RCATGY 2 cut(s) 63, 101
BstPI GGTNACC 1 cut(s) 140
BstSCI CCNGG 1 cut(s) 147
BstSFI CTRYAG 1 cut(s) 255
BstX2I RGATCY 2 cut(s) 68, 106
BstYI RGATCY 2 cut(s) 68, 106
BtrI CACGTC 1 cut(s) 41
BtsCI GGATG 2 cut(s) 83, 111
BtsIMutI CAGTG 1 cut(s) 187
CviAII CATG 2 cut(s) 60, 98
CviJI RGCY 5 cut(s) 26, 93, 180, 203, 260
CviKI_1 RGCY 5 cut(s) 26, 93, 180, 203, 260
DpnI GATC 4 cut(s) 6, 70, 84, 108
DpnII GATC 4 cut(s) 4, 68, 82, 106
Eco130I CCWWGG 1 cut(s) 72
Eco91I GGTNACC 1 cut(s) 140
EcoO65I GGTNACC 1 cut(s) 140
EcoRII CCWGG 1 cut(s) 147
EcoT14I CCWWGG 1 cut(s) 72
ErhI CCWWGG 1 cut(s) 72
FaeI CATG 2 cut(s) 63, 101
FaiI YATR 4 cut(s) 35, 61, 87, 99
FatI CATG 2 cut(s) 59, 97
FokI GGATG 2 cut(s) 90, 98
HapII CCGG 1 cut(s) 66
Hin1II CATG 2 cut(s) 63, 101
HinfI GANTC 1 cut(s) 246
HpaII CCGG 1 cut(s) 66
HphI GGTGA 1 cut(s) 152
Hpy188I TCNGA 3 cut(s) 116, 123, 245
Hpy188III TCNNGA 2 cut(s) 44, 236
HpyCH4IV ACGT 1 cut(s) 40
HpyCH4V TGCA 2 cut(s) 63, 101
HpySE526I ACGT 1 cut(s) 40
Hsp92II CATG 2 cut(s) 63, 101
Kzo9I GATC 4 cut(s) 4, 68, 82, 106
LpnPI CCDG 7 cut(s) 37, 79, 103, 117, 134, 161, 175
LweI GCATC 1 cut(s) 68
MaeII ACGT 1 cut(s) 40
MaeIII GTNAC 2 cut(s) 55, 140
MalI GATC 4 cut(s) 6, 70, 84, 108
MboI GATC 4 cut(s) 4, 68, 82, 106
MflI RGATCY 2 cut(s) 68, 106
MlyI GAGTC 1 cut(s) 255
MseI TTAA 1 cut(s) 128
MspI CCGG 1 cut(s) 66
MspR9I CCNGG 1 cut(s) 149
MvaI CCWGG 1 cut(s) 149
NdeII GATC 4 cut(s) 4, 68, 82, 106
NlaIII CATG 2 cut(s) 63, 101
NlaIV GGNNCC 1 cut(s) 70
NmuCI GTSAC 2 cut(s) 55, 140
NspI RCATGY 2 cut(s) 63, 101
PleI GAGTC 1 cut(s) 254
PpsI GAGTC 1 cut(s) 254
Psp6I CCWGG 1 cut(s) 147
PspEI GGTNACC 1 cut(s) 140
PspGI CCWGG 1 cut(s) 147
PspN4I GGNNCC 1 cut(s) 70
PsuI RGATCY 2 cut(s) 68, 106
SaqAI TTAA 1 cut(s) 128
Sau3AI GATC 4 cut(s) 4, 68, 82, 106
SchI GAGTC 1 cut(s) 255
ScrFI CCNGG 1 cut(s) 149
SetI ASST 4 cut(s) 28, 43, 95, 150
SfaNI GCATC 1 cut(s) 68
SfcI CTRYAG 1 cut(s) 255
StyD4I CCNGG 1 cut(s) 147
StyI CCWWGG 1 cut(s) 72
TaiI ACGT 1 cut(s) 43
Tru1I TTAA 1 cut(s) 128
Tru9I TTAA 1 cut(s) 128
TscAI CASTG 1 cut(s) 194
TseFI GTSAC 2 cut(s) 55, 140
Tsp45I GTSAC 2 cut(s) 55, 140
TspRI CASTG 1 cut(s) 194
XceI RCATGY 2 cut(s) 63, 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.