pycom14g05160

Protein cornichon homolog

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
Physical Location & Seq
Forward (+)
4955027 .. 4957376
2350 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom14g05160.2

Sequence Viewer

Length: 438 bp
ATGGCTTGGGAATTGATGTATTGGCTGATCTGCTTCTGCGTCGACCTTGCCTTCTTCGCCTCCAGCCTTTACCAGTATGTGATGTTAACAGACTTGGAGGCTGACTATATCAACCCGTACGAACTATCAAATCGCATCAATCAATTGGTTGTCCCTGAGTTCATATTGCACATTGTGTTCTGTGCTTTTTTCCTCTTGGCTCGACGTTGGTTCATGTTCCTCATTACAGTCCCTCTTACTAGCTATATTGTGATGTTGTTTGTAAAACAGCAGCATCTTATTGATGTTACTGAAGTGTTCAGGGTTCTTAATACTGAGAAGAAGTGCAGGCTTGTCAAACTTGGTTTCTACTTTTGCCTTCTCGCTGTAATCATCATCAGGCTTACATTAGCTGCTTTCAACTCTTTGACTAGTGAAGAACATGCTGTGATATTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

146

Amino Acids

17.17

Weight (kDa)

5.86

Isoelectric Point (pI)

35.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012351)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 42
AcuI CTGAAG 1 cut(s) 312
AdeI CACNNNGTG 1 cut(s) 175
AfaI GTAC 1 cut(s) 119
AgsI TTSAA 1 cut(s) 400
AhlI ACTAGT 1 cut(s) 410
AluBI AGCT 2 cut(s) 243, 392
AluI AGCT 2 cut(s) 243, 392
ApeKI GCWGC 2 cut(s) 271, 392
BbvI GCAGC 2 cut(s) 283, 379
BcuI ACTAGT 1 cut(s) 410
BfaI CTAG 2 cut(s) 240, 411
BisI GCNGC 2 cut(s) 272, 393
BlsI GCNGC 2 cut(s) 273, 394
BmsI GCATC 2 cut(s) 144, 283
BpmI CTGGAG 1 cut(s) 46
Bse1I ACTGG 1 cut(s) 73
BseMII CTCAG 2 cut(s) 147, 306
BseNI ACTGG 1 cut(s) 73
BseXI GCAGC 2 cut(s) 283, 379
BsgI GTGCAG 1 cut(s) 346
BsiWI CGTACG 1 cut(s) 117
BslFI GGGAC 2 cut(s) 137, 215
BsmFI GGGAC 2 cut(s) 137, 215
Bsp143I GATC 1 cut(s) 27
BspCNI CTCAG 2 cut(s) 148, 307
BsrI ACTGG 1 cut(s) 73
BssMI GATC 1 cut(s) 27
Bst4CI ACNGT 1 cut(s) 229
BstC8I GCNNGC 1 cut(s) 329
BstDEI CTNAG 2 cut(s) 156, 315
BstKTI GATC 1 cut(s) 30
BstMBI GATC 1 cut(s) 27
BstMWI GCNNNNNNNGC 1 cut(s) 56
BstNSI RCATGY 1 cut(s) 425
BstV1I GCAGC 2 cut(s) 283, 379
Cac8I GCNNGC 1 cut(s) 329
CseI GACGC 1 cut(s) 28
Csp6I GTAC 1 cut(s) 118
CviAII CATG 2 cut(s) 214, 422
CviJI RGCY 9 cut(s) 5, 25, 66, 101, 200, 243, 331, 382, 392
CviKI_1 RGCY 9 cut(s) 5, 25, 66, 101, 200, 243, 331, 382, 392
CviQI GTAC 1 cut(s) 118
DdeI CTNAG 2 cut(s) 156, 315
DpnI GATC 1 cut(s) 29
DpnII GATC 1 cut(s) 27
DraIII CACNNNGTG 1 cut(s) 175
Eco57I CTGAAG 1 cut(s) 312
FaeI CATG 2 cut(s) 217, 425
FaiI YATR 6 cut(s) 78, 108, 164, 215, 246, 423
FaqI GGGAC 2 cut(s) 137, 215
FatI CATG 2 cut(s) 213, 421
FblI GTMKAC 1 cut(s) 42
Fnu4HI GCNGC 2 cut(s) 272, 393
Fsp4HI GCNGC 2 cut(s) 272, 393
FspBI CTAG 2 cut(s) 240, 411
GluI GCNGC 2 cut(s) 272, 393
GsuI CTGGAG 1 cut(s) 46
HgaI GACGC 1 cut(s) 28
Hin1II CATG 2 cut(s) 217, 425
HincII GTYRAC 2 cut(s) 43, 87
HindII GTYRAC 2 cut(s) 43, 87
HpaI GTTAAC 1 cut(s) 87
Hpy166II GTNNAC 2 cut(s) 43, 87
Hpy8I GTNNAC 2 cut(s) 43, 87
Hpy99I CGWCG 2 cut(s) 44, 207
HpyAV CCTTC 2 cut(s) 61, 368
HpyCH4III ACNGT 1 cut(s) 229
HpyCH4IV ACGT 1 cut(s) 205
HpyCH4V TGCA 2 cut(s) 169, 327
HpyF10VI GCNNNNNNNGC 1 cut(s) 56
HpyF3I CTNAG 2 cut(s) 156, 315
HpySE526I ACGT 1 cut(s) 205
Hsp92II CATG 2 cut(s) 217, 425
KspAI GTTAAC 1 cut(s) 87
Kzo9I GATC 1 cut(s) 27
LpnPI CCDG 6 cut(s) 76, 86, 168, 286, 313, 364
Lsp1109I GCAGC 2 cut(s) 283, 379
LweI GCATC 2 cut(s) 144, 283
MaeI CTAG 2 cut(s) 240, 411
MaeII ACGT 1 cut(s) 205
MaeIII GTNAC 1 cut(s) 286
MalI GATC 1 cut(s) 29
MboI GATC 1 cut(s) 27
MboII GAAGA 3 cut(s) 46, 331, 428
MfeI CAATTG 1 cut(s) 143
MluCI AATT 2 cut(s) 11, 143
MnlI CCTC 5 cut(s) 70, 91, 203, 230, 243
MseI TTAA 2 cut(s) 86, 309
MunI CAATTG 1 cut(s) 143
MwoI GCNNNNNNNGC 1 cut(s) 56
NdeII GATC 1 cut(s) 27
NlaIII CATG 2 cut(s) 217, 425
NspI RCATGY 1 cut(s) 425
Pfl23II CGTACG 1 cut(s) 117
PkrI GCNGC 2 cut(s) 273, 394
PspLI CGTACG 1 cut(s) 117
RsaI GTAC 1 cut(s) 119
RsaNI GTAC 1 cut(s) 118
SalI GTCGAC 1 cut(s) 41
SaqAI TTAA 2 cut(s) 86, 309
SatI GCNGC 2 cut(s) 272, 393
Sau3AI GATC 1 cut(s) 27
SetI ASST 4 cut(s) 48, 208, 245, 394
SfaNI GCATC 2 cut(s) 144, 283
SpeI ACTAGT 1 cut(s) 410
Sse9I AATT 2 cut(s) 11, 143
SspMI CTAG 2 cut(s) 240, 411
TaaI ACNGT 1 cut(s) 229
TaiI ACGT 1 cut(s) 208
TaqI TCGA 2 cut(s) 42, 202
TasI AATT 2 cut(s) 11, 143
Tru1I TTAA 2 cut(s) 86, 309
Tru9I TTAA 2 cut(s) 86, 309
TseI GCWGC 2 cut(s) 271, 392
TspDTI ATGAA 2 cut(s) 151, 202
XceI RCATGY 1 cut(s) 425
XmiI GTMKAC 1 cut(s) 42
XspI CTAG 2 cut(s) 240, 411
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.