Rmu_sc0001135.1_g000001

Protein cornichon homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001135.1
Physical Location & Seq
Reverse (-)
1 .. 974
974 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001135.1_g000001.1.cds

Sequence Viewer

Length: 257 bp
atggcttgggatttgatctattggctactctgcttctgcatcgacattgccctcttcgcttcaagcctttatcagtatgtgatgctaacggatttggaggcagactatatcaatccgtttgaattatcgactcgcatcaatcaattggtcgtccctgagttcattgtgcatggagtgttctgtgctctgttcctcctggcacagcgttggttcatgttcctcttcacagtcccccttacttactatatcgtgatgct
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

10.25

Weight (kDa)

4.14

Isoelectric Point (pI)

24.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012351)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 63, 122
AjnI CCWGG 1 cut(s) 195
Alw21I GWGCWC 1 cut(s) 187
Bbv12I GWGCWC 1 cut(s) 187
BciT130I CCWGG 1 cut(s) 197
Bme1390I CCNGG 1 cut(s) 197
BmrFI CCNGG 1 cut(s) 197
BmsI GCATC 4 cut(s) 48, 72, 144, 243
Bse3DI GCAATG 1 cut(s) 45
BseBI CCWGG 1 cut(s) 197
BseMI GCAATG 1 cut(s) 45
BseMII CTCAG 1 cut(s) 147
BsiHKAI GWGCWC 1 cut(s) 187
BslFI GGGAC 2 cut(s) 137, 215
BsmFI GGGAC 2 cut(s) 137, 215
Bsp1286I GDGCHC 1 cut(s) 187
Bsp143I GATC 1 cut(s) 15
BspCNI CTCAG 1 cut(s) 148
BsrDI GCAATG 1 cut(s) 45
BssMI GATC 1 cut(s) 15
Bst2UI CCWGG 1 cut(s) 197
Bst4CI ACNGT 1 cut(s) 229
Bst6I CTCTTC 2 cut(s) 59, 227
BstDEI CTNAG 1 cut(s) 156
BstKTI GATC 1 cut(s) 18
BstMBI GATC 1 cut(s) 15
BstMWI GCNNNNNNNGC 1 cut(s) 56
BstNI CCWGG 1 cut(s) 197
BstSCI CCNGG 1 cut(s) 195
CviAII CATG 2 cut(s) 170, 214
CviJI RGCY 3 cut(s) 5, 25, 66
CviKI_1 RGCY 3 cut(s) 5, 25, 66
DdeI CTNAG 1 cut(s) 156
DpnI GATC 1 cut(s) 17
DpnII GATC 1 cut(s) 15
Eam1104I CTCTTC 2 cut(s) 59, 227
EarI CTCTTC 2 cut(s) 59, 227
EcoRII CCWGG 1 cut(s) 195
FaeI CATG 2 cut(s) 173, 217
FaiI YATR 5 cut(s) 78, 108, 171, 215, 246
FaqI GGGAC 2 cut(s) 137, 215
FatI CATG 2 cut(s) 169, 213
Hin1II CATG 2 cut(s) 173, 217
HinfI GANTC 1 cut(s) 130
Hpy188III TCNNGA 1 cut(s) 250
HpyCH4III ACNGT 1 cut(s) 229
HpyCH4V TGCA 2 cut(s) 39, 169
HpyF10VI GCNNNNNNNGC 1 cut(s) 56
HpyF3I CTNAG 1 cut(s) 156
Hsp92II CATG 2 cut(s) 173, 217
Kzo9I GATC 1 cut(s) 15
LpnPI CCDG 3 cut(s) 168, 182, 209
LweI GCATC 4 cut(s) 48, 72, 144, 243
MalI GATC 1 cut(s) 17
MboI GATC 1 cut(s) 15
MboII GAAGA 2 cut(s) 46, 214
MfeI CAATTG 1 cut(s) 143
MhlI GDGCHC 1 cut(s) 187
MluCI AATT 2 cut(s) 122, 143
MlyI GAGTC 1 cut(s) 124
MnlI CCTC 4 cut(s) 62, 91, 203, 230
MspR9I CCNGG 1 cut(s) 197
MunI CAATTG 1 cut(s) 143
MvaI CCWGG 1 cut(s) 197
MwoI GCNNNNNNNGC 1 cut(s) 56
NdeII GATC 1 cut(s) 15
NlaIII CATG 2 cut(s) 173, 217
PleI GAGTC 1 cut(s) 124
PpsI GAGTC 1 cut(s) 124
Psp6I CCWGG 1 cut(s) 195
PspGI CCWGG 1 cut(s) 195
Sau3AI GATC 1 cut(s) 15
SchI GAGTC 1 cut(s) 124
ScrFI CCNGG 1 cut(s) 197
SduI GDGCHC 1 cut(s) 187
SfaNI GCATC 4 cut(s) 48, 72, 144, 243
SgeI CNNG 8 cut(s) 18, 75, 144, 167, 182, 208, 209, 226
Sse9I AATT 2 cut(s) 122, 143
StyD4I CCNGG 1 cut(s) 195
TaaI ACNGT 1 cut(s) 229
TaqI TCGA 2 cut(s) 42, 128
TasI AATT 2 cut(s) 122, 143
TspDTI ATGAA 2 cut(s) 151, 202
TspGWI ACGGA 2 cut(s) 104, 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.