pycom14g17640

Protein of unknown function (DUF1118)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
OG0013432
Physical Location & Seq
Forward (+)
19498568 .. 19499264
697 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom14g17640.1

Sequence Viewer

Length: 552 bp
ATGGAGGCCAGAGCATTTTACAGCGGCAGCACCGGCGGTGTGCCTTTCGCTTTCAGAGCACCAGCAGCAGCAAAAGGAGGCAACTTTGCTCCCTCCTCCCCTCTCCTCATCCAATCCATGGCTACCTTGAAACCCATTCCTTCAGCTACCAACACAGTCAGCTCCAAGAAGGTTAATAATCTTCCTCTCATTCAAAATATGTATGACGGGGTGGAGCAACTGAAGCTGCTGACCAAAGCAGAGAAAGCCGGCCTGCTGTCCACGGCAGAGAAGTCCGGGCTCTCATTGTCCGTGATAGAGAAGCTAGGGTTGCTCTCCAAGGCGGAGGAATTCGGAATCCTATCTGCAGCCACCGACCCGGGAACTCCCGGGGCATTGTTGAGTTTAAGCTTAGGACTGCTGGTTTTGGGTCCATTTGTTGTATATCTTGTGCCTGAGGATTCTCCTTTGGAGATAGGGCTACAAGCTGTTGTTGCTTTGGCTGCAATAGCGGGTGGTTCCGCTGCTTTTGCTGCATCAAATCTTGTATCCAGTTTGCAGAAATCTAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1118

Protein Analysis

184

Amino Acids

18.57

Weight (kDa)

7.91

Isoelectric Point (pI)

43.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1118 PF06549 71 - 182 1.7e-44 Protein of unknown function (DUF1118)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013432)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G08050
fragaria_vesca FvH4_5g13740
malus_domestica MD06G1225900.v1.1 MD14G1212800.v1.1
prunus_persica Prupe.5G206100_v2.0.a1
pyrus_communis pycom06g18030 pycom14g17640
rosa_chinensis RchiOBHm_Chr7g0183201
rosa_laevigata RLG00000005067
rosa_multiflora Rmu_sc0006717.1_g000006 Rmu_ssc0000111.1_g000019
rosa_roxburghii Rroxscaffold_3G00270660
rosa_rugosa Rorug06G0454800
rosa_samantha Rh7AG057200 Rh7BG056900 Rh7CG058000 Rh7DG056800
rosa_wichuraiana Rw7G004670

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 118
AciI CCGC 5 cut(s) 24, 36, 323, 491, 501
AcsI RAATTY 1 cut(s) 329
AcuI CTGAAG 2 cut(s) 126, 242
AfiI CCNNNNNNNGG 1 cut(s) 118
AgsI TTSAA 2 cut(s) 130, 194
AluBI AGCT 6 cut(s) 146, 162, 226, 304, 390, 467
AluI AGCT 6 cut(s) 146, 162, 226, 304, 390, 467
Alw21I GWGCWC 1 cut(s) 61
Ama87I CYCGRG 2 cut(s) 358, 368
AoxI GGCC 2 cut(s) 6, 250
ApeKI GCWGC 8 cut(s) 27, 65, 68, 226, 347, 482, 503, 512
ApoI RAATTY 1 cut(s) 329
AspS9I GGNCC 1 cut(s) 410
AsuC2I CCSGG 5 cut(s) 277, 359, 360, 369, 370
AvaI CYCGRG 2 cut(s) 358, 368
AvaII GGWCC 1 cut(s) 410
AxyI CCTNAGG 1 cut(s) 435
BanII GRGCYC 1 cut(s) 282
Bbv12I GWGCWC 1 cut(s) 61
BbvI GCAGC 8 cut(s) 39, 77, 80, 213, 359, 469, 490, 499
BceAI ACGGC 1 cut(s) 279
BciVI GTATCC 1 cut(s) 538
BcnI CCSGG 5 cut(s) 277, 359, 360, 369, 370
BfaI CTAG 1 cut(s) 305
BfmI CTRYAG 1 cut(s) 345
BfuI GTATCC 1 cut(s) 538
BisI GCNGC 9 cut(s) 25, 28, 66, 69, 227, 348, 483, 504, 513
BlsI GCNGC 9 cut(s) 26, 29, 67, 70, 228, 349, 484, 505, 514
Bme1390I CCNGG 5 cut(s) 277, 359, 360, 369, 370
Bme18I GGWCC 1 cut(s) 410
BmeT110I CYCGRG 2 cut(s) 358, 368
BmgT120I GGNCC 1 cut(s) 410
BmiI GGNNCC 2 cut(s) 411, 499
BmrFI CCNGG 5 cut(s) 277, 359, 360, 369, 370
BmsI GCATC 1 cut(s) 524
Bpu10I CCTNAGC 1 cut(s) 391
BpuMI CCSGG 5 cut(s) 277, 359, 360, 369, 370
BsaJI CCNNGG 6 cut(s) 117, 261, 318, 358, 368, 369
Bsc4I CCNNNNNNNGG 1 cut(s) 118
Bse118I RCCGGY 2 cut(s) 32, 248
Bse1I ACTGG 1 cut(s) 531
Bse21I CCTNAGG 1 cut(s) 435
BseDI CCNNGG 6 cut(s) 117, 261, 318, 358, 368, 369
BseGI GGATG 1 cut(s) 108
BseLI CCNNNNNNNGG 1 cut(s) 118
BseMII CTCAG 1 cut(s) 426
BseNI ACTGG 1 cut(s) 531
BseRI GAGGAG 2 cut(s) 85, 95
BseXI GCAGC 8 cut(s) 39, 77, 80, 213, 359, 469, 490, 499
BshFI GGCC 2 cut(s) 8, 252
BsiHKAI GWGCWC 1 cut(s) 61
BsiHKCI CYCGRG 2 cut(s) 358, 368
BsiSI CCGG 5 cut(s) 33, 249, 276, 359, 369
BslI CCNNNNNNNGG 1 cut(s) 118
BsnI GGCC 2 cut(s) 8, 252
BsoBI CYCGRG 2 cut(s) 358, 368
Bsp1286I GDGCHC 2 cut(s) 61, 282
Bsp19I CCATGG 1 cut(s) 117
BspACI CCGC 5 cut(s) 24, 36, 323, 491, 501
BspANI GGCC 2 cut(s) 8, 252
BspCNI CTCAG 1 cut(s) 427
BspLI GGNNCC 2 cut(s) 411, 499
BspMAI CTGCAG 1 cut(s) 349
BsrFI RCCGGY 2 cut(s) 32, 248
BsrI ACTGG 1 cut(s) 531
BssAI RCCGGY 2 cut(s) 32, 248
BssECI CCNNGG 6 cut(s) 117, 261, 318, 358, 368, 369
BssT1I CCWWGG 2 cut(s) 117, 318
Bst4CI ACNGT 1 cut(s) 157
BstC8I GCNNGC 2 cut(s) 250, 254
BstDEI CTNAG 2 cut(s) 391, 435
BstDSI CCRYGG 2 cut(s) 117, 261
BstF5I GGATG 1 cut(s) 108
BstSCI CCNGG 5 cut(s) 275, 357, 358, 367, 368
BstSFI CTRYAG 1 cut(s) 345
BstV1I GCAGC 8 cut(s) 39, 77, 80, 213, 359, 469, 490, 499
Bsu36I CCTNAGG 1 cut(s) 435
BsuI GTATCC 1 cut(s) 538
BsuRI GGCC 2 cut(s) 8, 252
BtgI CCRYGG 2 cut(s) 117, 261
BtsCI GGATG 1 cut(s) 108
Cac8I GCNNGC 2 cut(s) 250, 254
Cfr10I RCCGGY 2 cut(s) 32, 248
Cfr13I GGNCC 1 cut(s) 410
Cfr9I CCCGGG 2 cut(s) 358, 368
CviAII CATG 1 cut(s) 118
DdeI CTNAG 2 cut(s) 391, 435
EciI GGCGGA 1 cut(s) 338
Eco130I CCWWGG 2 cut(s) 117, 318
Eco24I GRGCYC 1 cut(s) 282
Eco47I GGWCC 1 cut(s) 410
Eco57I CTGAAG 2 cut(s) 126, 242
Eco81I CCTNAGG 1 cut(s) 435
Eco88I CYCGRG 2 cut(s) 358, 368
EcoRI GAATTC 1 cut(s) 329
EcoT14I CCWWGG 2 cut(s) 117, 318
EcoT38I GRGCYC 1 cut(s) 282
ErhI CCWWGG 2 cut(s) 117, 318
FaeI CATG 1 cut(s) 121
FaiI YATR 4 cut(s) 119, 200, 204, 424
FatI CATG 1 cut(s) 117
FauI CCCGC 1 cut(s) 484
Fnu4HI GCNGC 9 cut(s) 25, 28, 66, 69, 227, 348, 483, 504, 513
FokI GGATG 1 cut(s) 95
FriOI GRGCYC 1 cut(s) 282
Fsp4HI GCNGC 9 cut(s) 25, 28, 66, 69, 227, 348, 483, 504, 513
FspBI CTAG 1 cut(s) 305
GluI GCNGC 9 cut(s) 25, 28, 66, 69, 227, 348, 483, 504, 513
HaeIII GGCC 2 cut(s) 8, 252
HapII CCGG 5 cut(s) 33, 249, 276, 359, 369
Hin1II CATG 1 cut(s) 121
HindIII AAGCTT 1 cut(s) 388
HinfI GANTC 2 cut(s) 336, 440
HpaII CCGG 5 cut(s) 33, 249, 276, 359, 369
Hpy166II GTNNAC 1 cut(s) 261
Hpy188I TCNGA 2 cut(s) 56, 335
Hpy8I GTNNAC 1 cut(s) 261
HpyAV CCTTC 2 cut(s) 150, 163
HpyCH4III ACNGT 1 cut(s) 157
HpyCH4V TGCA 4 cut(s) 347, 485, 515, 538
HpyF3I CTNAG 2 cut(s) 391, 435
Hsp92II CATG 1 cut(s) 121
KroI GCCGGC 1 cut(s) 248
KroNI GCCGGC 1 cut(s) 250
LmnI GCTCC 3 cut(s) 94, 167, 214
Lsp1109I GCAGC 8 cut(s) 39, 77, 80, 213, 359, 469, 490, 499
LweI GCATC 1 cut(s) 524
MaeI CTAG 1 cut(s) 305
MboII GAAGA 1 cut(s) 173
MhlI GDGCHC 2 cut(s) 61, 282
MluCI AATT 2 cut(s) 329, 547
MnlI CCTC 8 cut(s) 71, 103, 106, 111, 116, 195, 319, 430
MroNI GCCGGC 1 cut(s) 248
MseI TTAA 2 cut(s) 174, 386
MspA1I CMGCKG 2 cut(s) 24, 503
MspI CCGG 5 cut(s) 33, 249, 276, 359, 369
MspR9I CCNGG 5 cut(s) 277, 359, 360, 369, 370
NaeI GCCGGC 1 cut(s) 250
NciI CCSGG 5 cut(s) 277, 359, 360, 369, 370
NcoI CCATGG 1 cut(s) 117
NgoMIV GCCGGC 1 cut(s) 248
NlaIII CATG 1 cut(s) 121
NlaIV GGNNCC 2 cut(s) 411, 499
PdiI GCCGGC 1 cut(s) 250
PfeI GAWTC 2 cut(s) 336, 440
PflMI CCANNNNNTGG 1 cut(s) 118
PkrI GCNGC 9 cut(s) 26, 29, 67, 70, 228, 349, 484, 505, 514
PspN4I GGNNCC 2 cut(s) 411, 499
PspPI GGNCC 1 cut(s) 410
PstI CTGCAG 1 cut(s) 349
SaqAI TTAA 2 cut(s) 174, 386
SatI GCNGC 9 cut(s) 25, 28, 66, 69, 227, 348, 483, 504, 513
Sau96I GGNCC 1 cut(s) 410
ScrFI CCNGG 5 cut(s) 277, 359, 360, 369, 370
SduI GDGCHC 2 cut(s) 61, 282
SetI ASST 8 cut(s) 128, 148, 164, 174, 228, 306, 392, 469
SfaNI GCATC 1 cut(s) 524
SfcI CTRYAG 1 cut(s) 345
SgrAI CRCCGGYG 1 cut(s) 32
SinI GGWCC 1 cut(s) 410
SmaI CCCGGG 2 cut(s) 360, 370
Sse9I AATT 2 cut(s) 329, 547
SsiI CCGC 5 cut(s) 24, 36, 323, 491, 501
SspMI CTAG 1 cut(s) 305
StyD4I CCNGG 5 cut(s) 275, 357, 358, 367, 368
StyI CCWWGG 2 cut(s) 117, 318
TaaI ACNGT 1 cut(s) 157
TasI AATT 2 cut(s) 329, 547
TauI GCSGC 1 cut(s) 27
TfiI GAWTC 2 cut(s) 336, 440
Tru1I TTAA 2 cut(s) 174, 386
Tru9I TTAA 2 cut(s) 174, 386
TseI GCWGC 8 cut(s) 27, 65, 68, 226, 347, 482, 503, 512
TspGWI ACGGA 1 cut(s) 280
TspMI CCCGGG 2 cut(s) 358, 368
Van91I CCANNNNNTGG 1 cut(s) 118
VpaK11BI GGWCC 1 cut(s) 410
XapI RAATTY 1 cut(s) 329
XmaI CCCGGG 2 cut(s) 358, 368
XspI CTAG 1 cut(s) 305
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.