pycom15g26940

Protein RMD5 homolog

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
22203685 .. 22204319
635 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 465 bp
ATGAATTCCAGGTCTAAAGCTCAAGAAGTGTTCGATCTGATCGACAAAGAAATGAAGCAGACGTTACAAAAGCTACAATCGTCTAATGGTTGTAAATCTCAGGTTGATTGTAAGTCTTCTCTTGCTGAACTTAAAGTCAAGATAAAAGATATAGCTCCACTCACTCAGTTGGAAAGCATGCAGAAGGAACTGAACCTAGCACTTAGCAAGTATCCAAAGATTCTGGAGAAATCCCTCATTCCTGATATTACCAAGGCTTATAGAAACATTGACATTGATACCCACACAACTAATGCGATTATTGGCGGCCATTTCTATCAGCAGGGCCTATTCGAAGTTGGCGACTATTTTATAAGTGAGACTGAGGAATCAGAAGCTGCGGCTGCATTGAAATCTCAGTTTCGGGAATTATTTCGGATAGTTGAGGCAATGAAACATCGGAATCTGGAGCCAACATGTCACTGA

Protein Analysis

155

Amino Acids

17.52

Weight (kDa)

6.43

Isoelectric Point (pI)

38.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 353
AciI CCGC 2 cut(s) 306, 380
AcoI YGGCCR 1 cut(s) 307
AcsI RAATTY 1 cut(s) 4
AflIII ACRYGT 1 cut(s) 455
AgsI TTSAA 1 cut(s) 391
AjnI CCWGG 1 cut(s) 8
AluBI AGCT 4 cut(s) 20, 73, 155, 377
AluI AGCT 4 cut(s) 20, 73, 155, 377
Alw26I GTCTC 1 cut(s) 353
AlwNI CAGNNNCTG 1 cut(s) 377
AoxI GGCC 2 cut(s) 307, 325
ApeKI GCWGC 2 cut(s) 377, 383
ApoI RAATTY 1 cut(s) 4
Asp700I GAANNNNTTC 1 cut(s) 411
AspS9I GGNCC 1 cut(s) 325
AsuII TTCGAA 1 cut(s) 333
BbsI GAAGAC 1 cut(s) 108
BbvI GCAGC 2 cut(s) 364, 370
BciT130I CCWGG 1 cut(s) 10
BciVI GTATCC 1 cut(s) 222
BcoDI GTCTC 1 cut(s) 353
BfaI CTAG 1 cut(s) 197
BfuI GTATCC 1 cut(s) 222
BisI GCNGC 4 cut(s) 307, 378, 381, 384
BlsI GCNGC 4 cut(s) 308, 379, 382, 385
Bme1390I CCNGG 1 cut(s) 10
BmgT120I GGNCC 1 cut(s) 325
BmiI GGNNCC 1 cut(s) 450
BmrFI CCNGG 1 cut(s) 10
BpiI GAAGAC 1 cut(s) 108
BpmI CTGGAG 1 cut(s) 245
Bpu14I TTCGAA 1 cut(s) 333
BpuEI CTTGAG 1 cut(s) 6
BsaJI CCNNGG 1 cut(s) 252
Bse3DI GCAATG 1 cut(s) 435
BseBI CCWGG 1 cut(s) 10
BseDI CCNNGG 1 cut(s) 252
BseMI GCAATG 1 cut(s) 435
BseMII CTCAG 4 cut(s) 113, 179, 354, 410
BseXI GCAGC 2 cut(s) 364, 370
BshFI GGCC 2 cut(s) 309, 327
BsmAI GTCTC 1 cut(s) 353
BsnI GGCC 2 cut(s) 309, 327
Bsp119I TTCGAA 1 cut(s) 333
Bsp143I GATC 2 cut(s) 34, 39
BspACI CCGC 2 cut(s) 306, 380
BspANI GGCC 2 cut(s) 309, 327
BspCNI CTCAG 4 cut(s) 112, 178, 355, 409
BspLI GGNNCC 1 cut(s) 450
BspT104I TTCGAA 1 cut(s) 333
BsrDI GCAATG 1 cut(s) 435
BssECI CCNNGG 1 cut(s) 252
BssMI GATC 2 cut(s) 34, 39
BssT1I CCWWGG 1 cut(s) 252
Bst2UI CCWGG 1 cut(s) 10
BstBI TTCGAA 1 cut(s) 333
BstC8I GCNNGC 1 cut(s) 179
BstDEI CTNAG 5 cut(s) 99, 165, 203, 363, 396
BstKTI GATC 2 cut(s) 37, 42
BstMAI GTCTC 1 cut(s) 353
BstMBI GATC 2 cut(s) 34, 39
BstMWI GCNNNNNNNGC 1 cut(s) 383
BstNI CCWGG 1 cut(s) 10
BstNSI RCATGY 2 cut(s) 181, 459
BstSCI CCNGG 1 cut(s) 8
BstV1I GCAGC 2 cut(s) 364, 370
BstV2I GAAGAC 1 cut(s) 108
BsuI GTATCC 1 cut(s) 222
BsuRI GGCC 2 cut(s) 309, 327
BtsIMutI CAGTG 1 cut(s) 460
Cac8I GCNNGC 1 cut(s) 179
CaiI CAGNNNCTG 1 cut(s) 377
Cfr13I GGNCC 1 cut(s) 325
CviAII CATG 2 cut(s) 178, 456
CviJI RGCY 9 cut(s) 20, 73, 155, 257, 309, 327, 377, 383, 451
CviKI_1 RGCY 9 cut(s) 20, 73, 155, 257, 309, 327, 377, 383, 451
DdeI CTNAG 5 cut(s) 99, 165, 203, 363, 396
DpnI GATC 2 cut(s) 36, 41
DpnII GATC 2 cut(s) 34, 39
EaeI YGGCCR 1 cut(s) 307
Eco130I CCWWGG 1 cut(s) 252
EcoO109I RGGNCCY 1 cut(s) 325
EcoRI GAATTC 1 cut(s) 4
EcoRII CCWGG 1 cut(s) 8
EcoT14I CCWWGG 1 cut(s) 252
ErhI CCWWGG 1 cut(s) 252
FaeI CATG 2 cut(s) 181, 459
FaiI YATR 5 cut(s) 152, 179, 261, 353, 457
FatI CATG 2 cut(s) 177, 455
Fnu4HI GCNGC 4 cut(s) 307, 378, 381, 384
Fsp4HI GCNGC 4 cut(s) 307, 378, 381, 384
FspBI CTAG 1 cut(s) 197
GluI GCNGC 4 cut(s) 307, 378, 381, 384
GsuI CTGGAG 1 cut(s) 245
HaeIII GGCC 2 cut(s) 309, 327
Hin1II CATG 2 cut(s) 181, 459
HinfI GANTC 3 cut(s) 220, 368, 442
Hpy188I TCNGA 4 cut(s) 39, 373, 417, 441
Hpy188III TCNNGA 6 cut(s) 23, 139, 224, 242, 404, 446
HpyAV CCTTC 1 cut(s) 178
HpyCH4IV ACGT 1 cut(s) 62
HpyCH4V TGCA 2 cut(s) 181, 386
HpyF10VI GCNNNNNNNGC 1 cut(s) 383
HpyF3I CTNAG 5 cut(s) 99, 165, 203, 363, 396
HpySE526I ACGT 1 cut(s) 62
Hsp92II CATG 2 cut(s) 181, 459
Kzo9I GATC 2 cut(s) 34, 39
LmnI GCTCC 2 cut(s) 160, 448
LpnPI CCDG 6 cut(s) 22, 86, 209, 255, 308, 431
Lsp1109I GCAGC 2 cut(s) 364, 370
MaeI CTAG 1 cut(s) 197
MaeII ACGT 1 cut(s) 62
MaeIII GTNAC 2 cut(s) 63, 458
MalI GATC 2 cut(s) 36, 41
MboI GATC 2 cut(s) 34, 39
MboII GAAGA 1 cut(s) 108
MluCI AATT 2 cut(s) 4, 407
MmeI TCCRAC 1 cut(s) 150
MnlI CCTC 3 cut(s) 245, 358, 418
MroXI GAANNNNTTC 1 cut(s) 411
MseI TTAA 1 cut(s) 132
MspR9I CCNGG 1 cut(s) 10
MvaI CCWGG 1 cut(s) 10
MwoI GCNNNNNNNGC 1 cut(s) 383
NdeII GATC 2 cut(s) 34, 39
NlaIII CATG 2 cut(s) 181, 459
NlaIV GGNNCC 1 cut(s) 450
NmuCI GTSAC 1 cut(s) 458
NspI RCATGY 2 cut(s) 181, 459
NspV TTCGAA 1 cut(s) 333
PaeI GCATGC 1 cut(s) 181
PciI ACATGT 1 cut(s) 455
PcsI WCGNNNNNNNCGW 2 cut(s) 39, 339
PdmI GAANNNNTTC 1 cut(s) 411
PfeI GAWTC 3 cut(s) 220, 368, 442
PkrI GCNGC 4 cut(s) 308, 379, 382, 385
PscI ACATGT 1 cut(s) 455
PsiI TTATAA 1 cut(s) 353
Psp6I CCWGG 1 cut(s) 8
PspGI CCWGG 1 cut(s) 8
PspN4I GGNNCC 1 cut(s) 450
PspPI GGNCC 1 cut(s) 325
PstNI CAGNNNCTG 1 cut(s) 377
SaqAI TTAA 1 cut(s) 132
SatI GCNGC 4 cut(s) 307, 378, 381, 384
Sau3AI GATC 2 cut(s) 34, 39
Sau96I GGNCC 1 cut(s) 325
ScrFI CCNGG 1 cut(s) 10
SetI ASST 8 cut(s) 14, 22, 65, 75, 105, 157, 198, 379
SfuI TTCGAA 1 cut(s) 333
SmlI CTYRAG 1 cut(s) 21
SmoI CTYRAG 1 cut(s) 21
SphI GCATGC 1 cut(s) 181
Sse9I AATT 2 cut(s) 4, 407
SsiI CCGC 2 cut(s) 306, 380
SspMI CTAG 1 cut(s) 197
StyD4I CCNGG 1 cut(s) 8
StyI CCWWGG 1 cut(s) 252
TaiI ACGT 1 cut(s) 65
TaqI TCGA 3 cut(s) 33, 42, 333
TasI AATT 2 cut(s) 4, 407
TauI GCSGC 2 cut(s) 309, 383
TfiI GAWTC 3 cut(s) 220, 368, 442
Tru1I TTAA 1 cut(s) 132
Tru9I TTAA 1 cut(s) 132
TseFI GTSAC 1 cut(s) 458
TseI GCWGC 2 cut(s) 377, 383
Tsp45I GTSAC 1 cut(s) 458
TspDTI ATGAA 3 cut(s) 17, 68, 446
XapI RAATTY 1 cut(s) 4
XceI RCATGY 2 cut(s) 181, 459
XmnI GAANNNNTTC 1 cut(s) 411
XspI CTAG 1 cut(s) 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.