pycom15g29430

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
26275134 .. 26276770
1637 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g29430.3

Sequence Viewer

Length: 366 bp
ATGCTTAATAAGGCTTTAGAAATTGCACGGCGTGAAAAAAGAGTTGTTGAGGAGAGGAATATAAGAATTCTGATTGCACAGATGCATGTTATAATGGGAGAACTGGAAGAAGGCTTGAACAAATTCCAAGATCTGGTCAATGCAGATCCACGAGATTTTCGGCCTTATCTTTGTCGGGGAATTATCTACAGTCTACTAGATCAGAAAAAGGAAGCTGCAGAACAGTTTGAAACATATCGGGCTTTAGTGCCTGAAGAATTTCCACAAAGGGGATTTCTTAATGATGTTGTGTTGGCAGCAGCCAACAACAAATCCGGGGAACAGTTTAAGAAGGATTTTCATAAGGAGTTCTCATACAGGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

122

Amino Acids

14.28

Weight (kDa)

7.84

Isoelectric Point (pI)

47.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012220)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 92
AccB7I CCANNNNNTGG 1 cut(s) 133
AccI GTMKAC 1 cut(s) 193
AclWI GGATC 1 cut(s) 140
AcsI RAATTY 3 cut(s) 66, 122, 257
AcuI CTGAAG 1 cut(s) 273
AdeI CACNNNGTG 1 cut(s) 32
AfiI CCNNNNNNNGG 2 cut(s) 133, 269
AgsI TTSAA 2 cut(s) 118, 230
AluBI AGCT 1 cut(s) 215
AluI AGCT 1 cut(s) 215
AlwI GGATC 1 cut(s) 140
AoxI GGCC 1 cut(s) 161
ApeKI GCWGC 3 cut(s) 215, 296, 299
ApoI RAATTY 3 cut(s) 66, 122, 257
Asp700I GAANNNNTTC 2 cut(s) 122, 258
AsuC2I CCSGG 1 cut(s) 316
BauI CACGAG 1 cut(s) 150
BbvI GCAGC 3 cut(s) 202, 308, 311
BceAI ACGGC 1 cut(s) 44
BcnI CCSGG 1 cut(s) 316
BfaI CTAG 1 cut(s) 197
BfmI CTRYAG 2 cut(s) 187, 216
BglII AGATCT 1 cut(s) 130
BisI GCNGC 3 cut(s) 216, 297, 300
BlsI GCNGC 3 cut(s) 217, 298, 301
Bme1390I CCNGG 1 cut(s) 316
BmrFI CCNGG 1 cut(s) 316
BmsI GCATC 1 cut(s) 72
BpuMI CCSGG 1 cut(s) 316
BsaJI CCNNGG 1 cut(s) 315
Bsc4I CCNNNNNNNGG 2 cut(s) 133, 269
Bse1I ACTGG 1 cut(s) 108
BseDI CCNNGG 1 cut(s) 315
BseLI CCNNNNNNNGG 2 cut(s) 133, 269
BseNI ACTGG 1 cut(s) 108
BseRI GAGGAG 1 cut(s) 65
BseXI GCAGC 3 cut(s) 202, 308, 311
BshFI GGCC 1 cut(s) 163
BsiSI CCGG 1 cut(s) 315
BslI CCNNNNNNNGG 2 cut(s) 133, 269
BsnI GGCC 1 cut(s) 163
Bsp143I GATC 3 cut(s) 130, 145, 199
BspANI GGCC 1 cut(s) 163
BspMAI CTGCAG 1 cut(s) 220
BspPI GGATC 1 cut(s) 140
BsrI ACTGG 1 cut(s) 108
BssECI CCNNGG 1 cut(s) 315
BssMI GATC 3 cut(s) 130, 145, 199
BssSI CACGAG 1 cut(s) 150
Bst2BI CACGAG 1 cut(s) 150
Bst4CI ACNGT 3 cut(s) 191, 225, 324
BstKTI GATC 3 cut(s) 133, 148, 202
BstMBI GATC 3 cut(s) 130, 145, 199
BstNSI RCATGY 1 cut(s) 89
BstSCI CCNGG 1 cut(s) 314
BstSFI CTRYAG 2 cut(s) 187, 216
BstV1I GCAGC 3 cut(s) 202, 308, 311
BstX2I RGATCY 2 cut(s) 130, 145
BstYI RGATCY 2 cut(s) 130, 145
BsuRI GGCC 1 cut(s) 163
CviAII CATG 1 cut(s) 86
CviJI RGCY 6 cut(s) 14, 114, 163, 215, 242, 302
CviKI_1 RGCY 6 cut(s) 14, 114, 163, 215, 242, 302
DpnI GATC 3 cut(s) 132, 147, 201
DpnII GATC 3 cut(s) 130, 145, 199
DraIII CACNNNGTG 1 cut(s) 32
Eco57I CTGAAG 1 cut(s) 273
EcoRI GAATTC 1 cut(s) 66
EcoT22I ATGCAT 1 cut(s) 87
FaeI CATG 1 cut(s) 89
FaiI YATR 6 cut(s) 62, 87, 92, 235, 342, 355
FatI CATG 1 cut(s) 85
FblI GTMKAC 1 cut(s) 193
Fnu4HI GCNGC 3 cut(s) 216, 297, 300
Fsp4HI GCNGC 3 cut(s) 216, 297, 300
FspBI CTAG 1 cut(s) 197
GluI GCNGC 3 cut(s) 216, 297, 300
HaeIII GGCC 1 cut(s) 163
HapII CCGG 1 cut(s) 315
Hin1II CATG 1 cut(s) 89
HpaII CCGG 1 cut(s) 315
Hpy166II GTNNAC 1 cut(s) 194
Hpy188I TCNGA 2 cut(s) 72, 204
Hpy8I GTNNAC 1 cut(s) 194
HpyAV CCTTC 2 cut(s) 104, 325
HpyCH4III ACNGT 3 cut(s) 191, 225, 324
HpyCH4V TGCA 5 cut(s) 26, 77, 85, 143, 218
Hsp92II CATG 1 cut(s) 89
Kzo9I GATC 3 cut(s) 130, 145, 199
LpnPI CCDG 5 cut(s) 89, 119, 264, 328, 343
Lsp1109I GCAGC 3 cut(s) 202, 308, 311
LweI GCATC 1 cut(s) 72
MaeI CTAG 1 cut(s) 197
MalI GATC 3 cut(s) 132, 147, 201
MboI GATC 3 cut(s) 130, 145, 199
MboII GAAGA 2 cut(s) 119, 266
MflI RGATCY 2 cut(s) 130, 145
MluCI AATT 5 cut(s) 21, 66, 122, 180, 257
MnlI CCTC 2 cut(s) 43, 48
Mph1103I ATGCAT 1 cut(s) 87
MroXI GAANNNNTTC 2 cut(s) 122, 258
MseI TTAA 3 cut(s) 6, 279, 327
MspI CCGG 1 cut(s) 315
MspR9I CCNGG 1 cut(s) 316
NciI CCSGG 1 cut(s) 316
NdeII GATC 3 cut(s) 130, 145, 199
NlaIII CATG 1 cut(s) 89
NsiI ATGCAT 1 cut(s) 87
NspI RCATGY 1 cut(s) 89
PdmI GAANNNNTTC 2 cut(s) 122, 258
PflMI CCANNNNNTGG 1 cut(s) 133
PkrI GCNGC 3 cut(s) 217, 298, 301
PsiI TTATAA 1 cut(s) 92
PstI CTGCAG 1 cut(s) 220
PsuI RGATCY 2 cut(s) 130, 145
SaqAI TTAA 3 cut(s) 6, 279, 327
SatI GCNGC 3 cut(s) 216, 297, 300
Sau3AI GATC 3 cut(s) 130, 145, 199
ScrFI CCNGG 1 cut(s) 316
SetI ASST 1 cut(s) 217
SfaNI GCATC 1 cut(s) 72
SfcI CTRYAG 2 cut(s) 187, 216
Sse9I AATT 5 cut(s) 21, 66, 122, 180, 257
SspMI CTAG 1 cut(s) 197
StyD4I CCNGG 1 cut(s) 314
TaaI ACNGT 3 cut(s) 191, 225, 324
TasI AATT 5 cut(s) 21, 66, 122, 180, 257
Tru1I TTAA 3 cut(s) 6, 279, 327
Tru9I TTAA 3 cut(s) 6, 279, 327
TseI GCWGC 3 cut(s) 215, 296, 299
TspDTI ATGAA 1 cut(s) 329
Van91I CCANNNNNTGG 1 cut(s) 133
XapI RAATTY 3 cut(s) 66, 122, 257
XceI RCATGY 1 cut(s) 89
XmiI GTMKAC 1 cut(s) 193
XmnI GAANNNNTTC 2 cut(s) 122, 258
XspI CTAG 1 cut(s) 197
Zsp2I ATGCAT 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.