pycom17g07160

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Reverse (-)
5153029 .. 5153616
588 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 381 bp
ATGATAATTTTTCTGTATCTACTAAGATTTTATCCAAAAAACGGGTACTACTTTGAGATAATTTACGTTGCGTGTCTTCCAACCGTTTTGATTCATTCATATTCTCTCTCACTTGGTTCTTTCCAAACTCCCTCCATGAAAACTCTGTTCTTCAACTCCTCTCTTTGGTTTAGCGGAGATATGGTGATGTTGGGATTGGAGAGGTTGGTGGTGAACTTGAAATCCAAGTTGAGGTCTTTGAAGGTGAATAAGAAGCCTTACGACAAGATCGAAAAGAGTGAGAGCATGAGAGTTGAAATAAGGAGCAAGAAGGCCAGAAAGCTCATTGAAAAGACTATGCAAGTTGCAGATTCTCCCAAGTCTAAAACTTTTGCTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

127

Amino Acids

14.71

Weight (kDa)

9.93

Isoelectric Point (pI)

50.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 174
AfaI GTAC 1 cut(s) 47
AfiI CCNNNNNNNGG 3 cut(s) 41, 165, 231
AgsI TTSAA 5 cut(s) 154, 220, 241, 296, 329
AloI GAACNNNNNNTCC 2 cut(s) 206, 238
AluBI AGCT 1 cut(s) 322
AluI AGCT 1 cut(s) 322
AoxI GGCC 1 cut(s) 312
AsuHPI GGTGA 3 cut(s) 196, 223, 256
BbsI GAAGAC 1 cut(s) 68
BpiI GAAGAC 1 cut(s) 68
BsaXI ACNNNNNCTCC 2 cut(s) 168, 198
Bsc4I CCNNNNNNNGG 3 cut(s) 41, 165, 231
BseLI CCNNNNNNNGG 3 cut(s) 41, 165, 231
BseRI GAGGAG 1 cut(s) 148
BshFI GGCC 1 cut(s) 314
BslI CCNNNNNNNGG 3 cut(s) 41, 165, 231
BsnI GGCC 1 cut(s) 314
Bsp143I GATC 1 cut(s) 267
BspACI CCGC 1 cut(s) 174
BspANI GGCC 1 cut(s) 314
BssMI GATC 1 cut(s) 267
Bst4CI ACNGT 1 cut(s) 85
BstDEI CTNAG 1 cut(s) 23
BstKTI GATC 1 cut(s) 270
BstMBI GATC 1 cut(s) 267
BstV2I GAAGAC 1 cut(s) 68
BsuRI GGCC 1 cut(s) 314
Csp6I GTAC 1 cut(s) 46
CviAII CATG 2 cut(s) 136, 286
CviJI RGCY 3 cut(s) 256, 314, 322
CviKI_1 RGCY 3 cut(s) 256, 314, 322
CviQI GTAC 1 cut(s) 46
DdeI CTNAG 1 cut(s) 23
DpnI GATC 1 cut(s) 269
DpnII GATC 1 cut(s) 267
FaeI CATG 2 cut(s) 139, 289
FaiI YATR 5 cut(s) 100, 137, 182, 287, 338
FatI CATG 2 cut(s) 135, 285
HaeIII GGCC 1 cut(s) 314
Hin1II CATG 2 cut(s) 139, 289
HinfI GANTC 2 cut(s) 91, 350
HphI GGTGA 3 cut(s) 196, 223, 256
Hpy166II GTNNAC 1 cut(s) 214
Hpy8I GTNNAC 1 cut(s) 214
HpyAV CCTTC 2 cut(s) 235, 304
HpyCH4III ACNGT 1 cut(s) 85
HpyCH4IV ACGT 1 cut(s) 66
HpyCH4V TGCA 2 cut(s) 340, 347
HpyF3I CTNAG 1 cut(s) 23
HpySE526I ACGT 1 cut(s) 66
Hsp92II CATG 2 cut(s) 139, 289
Kzo9I GATC 1 cut(s) 267
LmnI GCTCC 1 cut(s) 303
LpnPI CCDG 1 cut(s) 328
MaeII ACGT 1 cut(s) 66
MalI GATC 1 cut(s) 269
MboI GATC 1 cut(s) 267
MboII GAAGA 2 cut(s) 68, 142
MluCI AATT 2 cut(s) 6, 60
MmeI TCCRAC 1 cut(s) 104
MnlI CCTC 4 cut(s) 142, 169, 195, 225
NdeII GATC 1 cut(s) 267
NlaIII CATG 2 cut(s) 139, 289
PcsI WCGNNNNNNNCGW 1 cut(s) 267
PfeI GAWTC 2 cut(s) 91, 350
RsaI GTAC 1 cut(s) 47
RsaNI GTAC 1 cut(s) 46
Sau3AI GATC 1 cut(s) 267
SetI ASST 5 cut(s) 69, 206, 236, 246, 324
Sse9I AATT 2 cut(s) 6, 60
SsiI CCGC 1 cut(s) 174
TaaI ACNGT 1 cut(s) 85
TaiI ACGT 1 cut(s) 69
TaqI TCGA 1 cut(s) 270
TasI AATT 2 cut(s) 6, 60
TfiI GAWTC 2 cut(s) 91, 350
TspDTI ATGAA 3 cut(s) 83, 87, 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.