pycom420g00800

Regulated-SNARE-like domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_420
OG0015867
Physical Location & Seq
Reverse (-)
994467 .. 995619
1153 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 231 bp
ATGATGGAAAATATTGAGAAGGTTCTTGATCGTGGTGAGAAGATTGAGCTGTTGGTGGATAAAACTGATAATCTTCGTTCCCAGGCCCAAGATTTCAGGACACAGGGAACAAAAATGAAAAGAAAGATGTGGCTTCAAAACATGAAGATGAAACTGATTGTCGTGGCAATCCTCGTTGTCATAGCACTCATCATATATTTATCTATTTGTCGTGGTTTCAAGTGTACCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04130 map04130
Pfam Domains
Protein Families
Longin Synaptobrevin

Protein Analysis

77

Amino Acids

8.9

Weight (kDa)

9.7

Isoelectric Point (pI)

53.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Synaptobrevin PF00957 1 - 65 3.5e-26 Synaptobrevin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015867)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G04750 AT1G04750 AT1G04750
prunus_persica Prupe.2G303700_v2.0.a1 Prupe.2G303800_v2.0.a1
pyrus_communis pycom420g00800
rosa_chinensis RchiOBHm_Chr1g0355041 RchiOBHm_Chr4g0422051 RchiOBHm_Chr6g0285081
rosa_multiflora Rmu_sc0026385.1_g000001
rosa_roxburghii Rroxscaffold_4G00300740
rosa_samantha Rh1AG256900 Rh5BG278700
rosa_wichuraiana Rw1G022640 Rw2G012290

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 226
AgsI TTSAA 2 cut(s) 137, 220
AjnI CCWGG 1 cut(s) 81
AluBI AGCT 1 cut(s) 49
AluI AGCT 1 cut(s) 49
AoxI GGCC 1 cut(s) 84
AspS9I GGNCC 1 cut(s) 85
AsuHPI GGTGA 1 cut(s) 47
BciT130I CCWGG 1 cut(s) 83
Bme1390I CCNGG 1 cut(s) 83
BmgT120I GGNCC 1 cut(s) 85
BmrFI CCNGG 1 cut(s) 83
BsaJI CCNNGG 1 cut(s) 81
BseBI CCWGG 1 cut(s) 83
BseDI CCNNGG 1 cut(s) 81
BshFI GGCC 1 cut(s) 86
BsnI GGCC 1 cut(s) 86
Bsp143I GATC 1 cut(s) 28
BspANI GGCC 1 cut(s) 86
BssECI CCNNGG 1 cut(s) 81
BssMI GATC 1 cut(s) 28
Bst2UI CCWGG 1 cut(s) 83
BstKTI GATC 1 cut(s) 31
BstMBI GATC 1 cut(s) 28
BstNI CCWGG 1 cut(s) 83
BstSCI CCNGG 1 cut(s) 81
BsuRI GGCC 1 cut(s) 86
Cfr13I GGNCC 1 cut(s) 85
Csp6I GTAC 1 cut(s) 225
CviAII CATG 1 cut(s) 142
CviJI RGCY 3 cut(s) 49, 86, 133
CviKI_1 RGCY 3 cut(s) 49, 86, 133
CviQI GTAC 1 cut(s) 225
DpnI GATC 1 cut(s) 30
DpnII GATC 1 cut(s) 28
EcoRII CCWGG 1 cut(s) 81
FaeI CATG 1 cut(s) 145
FaiI YATR 4 cut(s) 143, 182, 194, 196
FatI CATG 1 cut(s) 141
HaeIII GGCC 1 cut(s) 86
Hin1II CATG 1 cut(s) 145
HphI GGTGA 1 cut(s) 47
Hpy166II GTNNAC 1 cut(s) 225
Hpy188III TCNNGA 2 cut(s) 26, 97
Hpy8I GTNNAC 1 cut(s) 225
HpyAV CCTTC 1 cut(s) 13
Hsp92II CATG 1 cut(s) 145
Kzo9I GATC 1 cut(s) 28
LpnPI CCDG 4 cut(s) 68, 82, 89, 95
MalI GATC 1 cut(s) 30
MboI GATC 1 cut(s) 28
MboII GAAGA 3 cut(s) 52, 65, 157
MnlI CCTC 1 cut(s) 182
MslI CAYNNNNRTG 1 cut(s) 146
MspR9I CCNGG 1 cut(s) 83
MvaI CCWGG 1 cut(s) 83
NdeII GATC 1 cut(s) 28
NlaIII CATG 1 cut(s) 145
Psp6I CCWGG 1 cut(s) 81
PspGI CCWGG 1 cut(s) 81
PspPI GGNCC 1 cut(s) 85
RsaI GTAC 1 cut(s) 226
RsaNI GTAC 1 cut(s) 225
RseI CAYNNNNRTG 1 cut(s) 146
Sau3AI GATC 1 cut(s) 28
Sau96I GGNCC 1 cut(s) 85
ScrFI CCNGG 1 cut(s) 83
SetI ASST 3 cut(s) 24, 51, 230
SmiMI CAYNNNNRTG 1 cut(s) 146
SspI AATATT 1 cut(s) 13
StyD4I CCNGG 1 cut(s) 81
TspDTI ATGAA 3 cut(s) 131, 158, 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.