RchiOBHm_Chr7g0208081

Purine nucleobase transmembrane transport

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0010694
Physical Location & Seq
Forward (+)
25458174 .. 25458440
267 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 267 bp
ATGTCTGCCTCCGTTCTCGCCATCAATTCTGACTCCGAAAACACTACCGATCACATCTCTAAAGGTAAGTATGTGATCGGTTTCTTGTGTACCCTCGGCACCTCCGCGACTTACTCATTGTACCTTTCCCTTGTGCAACTTTCATTCCAGAAGGTGATAAAAAGAGAGACATTTTCTACTGTCTTGGATATGCAATTATACCCATCGTTTGTTGCGACATGTGGTTGTGTGGTAGGGCTTTTTGCAAGTGGGGAATGCAAAGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PUNUT

Protein Analysis

88

Amino Acids

9.44

Weight (kDa)

6.52

Isoelectric Point (pI)

31.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PUNUT PF16913 2 - 87 1.4e-27 Purine nucleobase transmembrane transport
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 98
AccII CGCG 1 cut(s) 107
AciI CCGC 1 cut(s) 105
AfaI GTAC 2 cut(s) 91, 122
AflIII ACRYGT 1 cut(s) 218
Alw26I GTCTC 1 cut(s) 161
AsuHPI GGTGA 1 cut(s) 166
BanI GGYRCC 1 cut(s) 98
BccI CCATC 2 cut(s) 29, 211
BcoDI GTCTC 1 cut(s) 161
BfaI CTAG 1 cut(s) 265
BmiI GGNNCC 1 cut(s) 100
BsaJI CCNNGG 1 cut(s) 94
BseDI CCNNGG 1 cut(s) 94
Bsh1236I CGCG 1 cut(s) 107
BshNI GGYRCC 1 cut(s) 98
BsmAI GTCTC 1 cut(s) 161
BsmI GAATGC 1 cut(s) 260
Bsp143I GATC 2 cut(s) 49, 75
BspACI CCGC 1 cut(s) 105
BspFNI CGCG 1 cut(s) 107
BspLI GGNNCC 1 cut(s) 100
BspT107I GGYRCC 1 cut(s) 98
BssECI CCNNGG 1 cut(s) 94
BssMI GATC 2 cut(s) 49, 75
Bst4CI ACNGT 1 cut(s) 181
BstFNI CGCG 1 cut(s) 107
BstKTI GATC 2 cut(s) 52, 78
BstMAI GTCTC 1 cut(s) 161
BstMBI GATC 2 cut(s) 49, 75
BstNSI RCATGY 1 cut(s) 222
BstUI CGCG 1 cut(s) 107
Csp6I GTAC 2 cut(s) 90, 121
CviAII CATG 1 cut(s) 219
CviJI RGCY 2 cut(s) 238, 264
CviKI_1 RGCY 2 cut(s) 238, 264
CviQI GTAC 2 cut(s) 90, 121
DpnI GATC 2 cut(s) 51, 77
DpnII GATC 2 cut(s) 49, 75
FaeI CATG 1 cut(s) 222
FaiI YATR 4 cut(s) 72, 191, 199, 220
FatI CATG 1 cut(s) 218
FspBI CTAG 1 cut(s) 265
Hin1II CATG 1 cut(s) 222
HinfI GANTC 1 cut(s) 32
HphI GGTGA 1 cut(s) 166
Hpy166II GTNNAC 1 cut(s) 90
Hpy188I TCNGA 2 cut(s) 31, 37
Hpy188III TCNNGA 1 cut(s) 148
Hpy8I GTNNAC 1 cut(s) 90
HpyAV CCTTC 1 cut(s) 145
HpyCH4III ACNGT 1 cut(s) 181
HpyCH4V TGCA 4 cut(s) 136, 193, 245, 258
Hsp92II CATG 1 cut(s) 222
Kzo9I GATC 2 cut(s) 49, 75
LpnPI CCDG 1 cut(s) 161
MaeI CTAG 1 cut(s) 265
MalI GATC 2 cut(s) 51, 77
MboI GATC 2 cut(s) 49, 75
MluCI AATT 2 cut(s) 25, 194
MlyI GAGTC 1 cut(s) 26
MnlI CCTC 3 cut(s) 19, 104, 112
Mva1269I GAATGC 1 cut(s) 260
MvnI CGCG 1 cut(s) 107
NdeII GATC 2 cut(s) 49, 75
NlaIII CATG 1 cut(s) 222
NlaIV GGNNCC 1 cut(s) 100
NmeAIII GCCGAG 1 cut(s) 75
NspI RCATGY 1 cut(s) 222
PciI ACATGT 1 cut(s) 218
PcsI WCGNNNNNNNCGW 1 cut(s) 212
PctI GAATGC 1 cut(s) 260
PleI GAGTC 1 cut(s) 26
PpsI GAGTC 1 cut(s) 26
PscI ACATGT 1 cut(s) 218
PspN4I GGNNCC 1 cut(s) 100
RsaI GTAC 2 cut(s) 91, 122
RsaNI GTAC 2 cut(s) 90, 121
Sau3AI GATC 2 cut(s) 49, 75
SchI GAGTC 1 cut(s) 26
SetI ASST 4 cut(s) 67, 104, 126, 156
SgeI CNNG 9 cut(s) 29, 97, 107, 118, 143, 160, 196, 231, 258
Sse9I AATT 2 cut(s) 25, 194
SsiI CCGC 1 cut(s) 105
SspMI CTAG 1 cut(s) 265
TaaI ACNGT 1 cut(s) 181
TasI AATT 2 cut(s) 25, 194
TspDTI ATGAA 1 cut(s) 132
XceI RCATGY 1 cut(s) 222
XspI CTAG 1 cut(s) 265
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.