RchiOBHm_Chr4g0399821

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
17062201 .. 17066739
4539 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 483 bp
ATGGGGGAGTCATCGTTTTTTGACACAATGATCAGTCATCTACGTTCAACATCCAAGTATTATACTGGTTATCCAAAGGATCTTGGGCCATCAAGGGTTATCCATTTTACATCAGAACGTGAATTTGTTCAGCTCCTTCATGAAGGTTATCCTGTGGTTGTGGCATTCACCATCAGGTGTAATCTTACAAAACATCTTGACAAAGTATTAGAGGAAGCTGCAGCTGAGTTTTATCCACATGTGAAATTTATGCGTGTTGAGTGTCCAAAATATCCTGGTTTCTGTATTACACGGCAGAAGAAGGAATATCCATTTATAGAAGTATTTCATAGTCCAGAACAAACATCTAGCCAGGGAAGGGTTGCTGATCCAAATATTACAAAGTACTCGGTGAAGGTTCTACCTTTCCATAACGACACAAGTGCCTATGGATTTAGAGAATTCTTCAGGCGTAATGGAATACGATCATCAAATCCACAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

160

Amino Acids

18.61

Weight (kDa)

8.96

Isoelectric Point (pI)

53.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 87, 362
AcsI RAATTY 3 cut(s) 122, 245, 440
AcuI CTGAAG 1 cut(s) 430
AfaI GTAC 1 cut(s) 386
AfiI CCNNNNNNNGG 1 cut(s) 358
AflIII ACRYGT 1 cut(s) 238
AgsI TTSAA 1 cut(s) 48
AjnI CCWGG 2 cut(s) 274, 351
AluBI AGCT 3 cut(s) 133, 218, 224
AluI AGCT 3 cut(s) 133, 218, 224
AlwI GGATC 2 cut(s) 87, 362
AoxI GGCC 1 cut(s) 86
ApeKI GCWGC 2 cut(s) 218, 221
ApoI RAATTY 3 cut(s) 122, 245, 440
Asp700I GAANNNNTTC 2 cut(s) 126, 324
AspS9I GGNCC 1 cut(s) 86
AsuHPI GGTGA 2 cut(s) 160, 403
BbvI GCAGC 2 cut(s) 205, 233
BccI CCATC 2 cut(s) 97, 179
BceAI ACGGC 1 cut(s) 308
BcgI CGANNNNNNTGC 2 cut(s) 404, 438
BciT130I CCWGG 2 cut(s) 276, 353
BclI TGATCA 1 cut(s) 30
BfaI CTAG 1 cut(s) 348
BfmI CTRYAG 1 cut(s) 219
BisI GCNGC 2 cut(s) 219, 222
BlsI GCNGC 2 cut(s) 220, 223
BmcAI AGTACT 1 cut(s) 386
Bme1390I CCNGG 2 cut(s) 276, 353
BmgT120I GGNCC 1 cut(s) 86
BmrFI CCNGG 2 cut(s) 276, 353
BsaJI CCNNGG 1 cut(s) 352
BsaXI ACNNNNNCTCC 1 cut(s) 29
Bsc4I CCNNNNNNNGG 1 cut(s) 358
Bse1I ACTGG 1 cut(s) 70
BseBI CCWGG 2 cut(s) 276, 353
BseDI CCNNGG 1 cut(s) 352
BseGI GGATG 1 cut(s) 50
BseLI CCNNNNNNNGG 1 cut(s) 358
BseMII CTCAG 1 cut(s) 216
BseNI ACTGG 1 cut(s) 70
BseXI GCAGC 2 cut(s) 205, 233
BshFI GGCC 1 cut(s) 88
BslI CCNNNNNNNGG 1 cut(s) 358
BsmI GAATGC 1 cut(s) 164
BsnI GGCC 1 cut(s) 88
Bsp143I GATC 4 cut(s) 30, 79, 367, 464
BspANI GGCC 1 cut(s) 88
BspCNI CTCAG 1 cut(s) 217
BspHI TCATGA 1 cut(s) 139
BspMAI CTGCAG 1 cut(s) 223
BspPI GGATC 2 cut(s) 87, 362
BsrI ACTGG 1 cut(s) 70
BssECI CCNNGG 1 cut(s) 352
BssMI GATC 4 cut(s) 30, 79, 367, 464
Bst2UI CCWGG 2 cut(s) 276, 353
Bst4CI ACNGT 1 cut(s) 480
BstDEI CTNAG 1 cut(s) 225
BstF5I GGATG 1 cut(s) 50
BstKTI GATC 4 cut(s) 33, 82, 370, 467
BstMBI GATC 4 cut(s) 30, 79, 367, 464
BstNI CCWGG 2 cut(s) 276, 353
BstNSI RCATGY 1 cut(s) 242
BstSCI CCNGG 2 cut(s) 274, 351
BstSFI CTRYAG 1 cut(s) 219
BstV1I GCAGC 2 cut(s) 205, 233
BstX2I RGATCY 1 cut(s) 79
BstYI RGATCY 1 cut(s) 79
BsuRI GGCC 1 cut(s) 88
BtsCI GGATG 1 cut(s) 50
CciI TCATGA 1 cut(s) 139
Cfr13I GGNCC 1 cut(s) 86
Csp6I GTAC 1 cut(s) 385
CviAII CATG 2 cut(s) 140, 239
CviJI RGCY 5 cut(s) 88, 133, 218, 224, 351
CviKI_1 RGCY 5 cut(s) 88, 133, 218, 224, 351
CviQI GTAC 1 cut(s) 385
DdeI CTNAG 1 cut(s) 225
DpnI GATC 4 cut(s) 32, 81, 369, 466
DpnII GATC 4 cut(s) 30, 79, 367, 464
Eco57I CTGAAG 1 cut(s) 430
EcoRI GAATTC 1 cut(s) 440
EcoRII CCWGG 2 cut(s) 274, 351
FaeI CATG 2 cut(s) 143, 242
FaiI YATR 8 cut(s) 63, 141, 240, 251, 317, 330, 411, 429
FatI CATG 2 cut(s) 139, 238
FbaI TGATCA 1 cut(s) 30
Fnu4HI GCNGC 2 cut(s) 219, 222
FokI GGATG 1 cut(s) 37
Fsp4HI GCNGC 2 cut(s) 219, 222
FspBI CTAG 1 cut(s) 348
GluI GCNGC 2 cut(s) 219, 222
HaeIII GGCC 1 cut(s) 88
Hin1II CATG 2 cut(s) 143, 242
HinfI GANTC 1 cut(s) 8
HphI GGTGA 2 cut(s) 160, 403
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 3 cut(s) 140, 197, 335
HpyAV CCTTC 5 cut(s) 137, 146, 295, 351, 388
HpyCH4III ACNGT 1 cut(s) 480
HpyCH4IV ACGT 2 cut(s) 43, 118
HpyCH4V TGCA 1 cut(s) 221
HpyF3I CTNAG 1 cut(s) 225
HpySE526I ACGT 2 cut(s) 43, 118
Hsp92II CATG 2 cut(s) 143, 242
Ksp22I TGATCA 1 cut(s) 30
Kzo9I GATC 4 cut(s) 30, 79, 367, 464
LmnI GCTCC 1 cut(s) 138
LpnPI CCDG 9 cut(s) 51, 160, 165, 261, 288, 338, 348, 365, 433
Lsp1109I GCAGC 2 cut(s) 205, 233
MaeI CTAG 1 cut(s) 348
MaeII ACGT 2 cut(s) 43, 118
MalI GATC 4 cut(s) 32, 81, 369, 466
MboI GATC 4 cut(s) 30, 79, 367, 464
MboII GAAGA 2 cut(s) 310, 436
MflI RGATCY 1 cut(s) 79
MluCI AATT 3 cut(s) 122, 245, 440
MlyI GAGTC 1 cut(s) 17
MnlI CCTC 1 cut(s) 205
MroXI GAANNNNTTC 2 cut(s) 126, 324
MspA1I CMGCKG 1 cut(s) 224
MspR9I CCNGG 2 cut(s) 276, 353
Mva1269I GAATGC 1 cut(s) 164
MvaI CCWGG 2 cut(s) 276, 353
NdeII GATC 4 cut(s) 30, 79, 367, 464
NlaIII CATG 2 cut(s) 143, 242
NspI RCATGY 1 cut(s) 242
PagI TCATGA 1 cut(s) 139
PciI ACATGT 1 cut(s) 238
PctI GAATGC 1 cut(s) 164
PdmI GAANNNNTTC 2 cut(s) 126, 324
PkrI GCNGC 2 cut(s) 220, 223
PleI GAGTC 1 cut(s) 16
PpsI GAGTC 1 cut(s) 16
PscI ACATGT 1 cut(s) 238
Psp6I CCWGG 2 cut(s) 274, 351
PspGI CCWGG 2 cut(s) 274, 351
PspPI GGNCC 1 cut(s) 86
PstI CTGCAG 1 cut(s) 223
PsuI RGATCY 1 cut(s) 79
PvuII CAGCTG 1 cut(s) 224
RsaI GTAC 1 cut(s) 386
RsaNI GTAC 1 cut(s) 385
SatI GCNGC 2 cut(s) 219, 222
Sau3AI GATC 4 cut(s) 30, 79, 367, 464
Sau96I GGNCC 1 cut(s) 86
ScaI AGTACT 1 cut(s) 386
SchI GAGTC 1 cut(s) 17
ScrFI CCNGG 2 cut(s) 276, 353
SetI ASST 9 cut(s) 46, 121, 135, 148, 179, 220, 226, 399, 406
SfcI CTRYAG 1 cut(s) 219
Sse9I AATT 3 cut(s) 122, 245, 440
SspI AATATT 1 cut(s) 376
SspMI CTAG 1 cut(s) 348
StyD4I CCNGG 2 cut(s) 274, 351
TaaI ACNGT 1 cut(s) 480
TaiI ACGT 2 cut(s) 46, 121
TasI AATT 3 cut(s) 122, 245, 440
TatI WGTACW 1 cut(s) 384
TseI GCWGC 2 cut(s) 218, 221
TspDTI ATGAA 3 cut(s) 128, 156, 317
XapI RAATTY 3 cut(s) 122, 245, 440
XceI RCATGY 1 cut(s) 242
XmnI GAANNNNTTC 2 cut(s) 126, 324
XspI CTAG 1 cut(s) 348
ZrmI AGTACT 1 cut(s) 386
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.