RchiOBHm_Chr4g0446251

Oxygen evolving enhancer protein 3 (PsbQ)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
66499008 .. 66500596
1589 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 339 bp
ATGGTGGATATGCAATCAAAGGGAATTGCTTGTAGGATTAAGAAGTGTGCCTATGAATTGCTGTCGATTGGTGGTGATCTGATGGACGACGCTTACTCGTGGGACTTGAAGGGAAGGGATATACGCCTCAAATCGATGTTCTTGTTTTGTGATCTAAGTCAGTTGATCTCTAACGTCCCAAAGGATCAGAAGAAGGCCCTGACAGAAGTTGGCAACAAATTGTTTTCCTCCATCGAAGAGTTGGATCATGCAGTGAAAATTCGTAGCATTCCGTTGACTCAAGACCGATACAACGAGGCCGGTGTCATTCTACAGGAGCTGATGGTTCTCATGCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

12.7

Weight (kDa)

5.79

Isoelectric Point (pI)

39.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PsbQ PF05757 3 - 112 3.1e-22 Oxygen evolving enhancer protein 3
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 192, 252
AcsI RAATTY 1 cut(s) 258
AgsI TTSAA 1 cut(s) 109
AluBI AGCT 1 cut(s) 319
AluI AGCT 1 cut(s) 319
AlwI GGATC 2 cut(s) 192, 252
AlwNI CAGNNNCTG 1 cut(s) 319
AoxI GGCC 2 cut(s) 195, 297
ApoI RAATTY 1 cut(s) 258
AspS9I GGNCC 1 cut(s) 196
AsuHPI GGTGA 1 cut(s) 86
BauI CACGAG 1 cut(s) 97
BccI CCATC 3 cut(s) 76, 239, 316
BfmI CTRYAG 1 cut(s) 311
BmgT120I GGNCC 1 cut(s) 196
BpuEI CTTGAG 1 cut(s) 264
Bsa29I ATCGAT 1 cut(s) 134
Bse118I RCCGGY 1 cut(s) 299
BseCI ATCGAT 1 cut(s) 134
BshFI GGCC 2 cut(s) 197, 299
BshVI ATCGAT 1 cut(s) 134
BsiSI CCGG 1 cut(s) 300
BslFI GGGAC 2 cut(s) 116, 161
BsmFI GGGAC 2 cut(s) 116, 161
BsmI GAATGC 1 cut(s) 267
BsnI GGCC 2 cut(s) 197, 299
Bsp143I GATC 5 cut(s) 76, 151, 165, 184, 244
BspANI GGCC 2 cut(s) 197, 299
BspDI ATCGAT 1 cut(s) 134
BspPI GGATC 2 cut(s) 192, 252
BsrFI RCCGGY 1 cut(s) 299
BssAI RCCGGY 1 cut(s) 299
BssMI GATC 5 cut(s) 76, 151, 165, 184, 244
BssSI CACGAG 1 cut(s) 97
Bst2BI CACGAG 1 cut(s) 97
Bst6I CTCTTC 1 cut(s) 231
BstDEI CTNAG 1 cut(s) 155
BstKTI GATC 5 cut(s) 79, 154, 168, 187, 247
BstMBI GATC 5 cut(s) 76, 151, 165, 184, 244
BstSFI CTRYAG 1 cut(s) 311
Bsu15I ATCGAT 1 cut(s) 134
BsuRI GGCC 2 cut(s) 197, 299
BsuTUI ATCGAT 1 cut(s) 134
BtsI GCAGTG 1 cut(s) 258
BtsIMutI CAGTG 1 cut(s) 258
CaiI CAGNNNCTG 1 cut(s) 319
Cfr10I RCCGGY 1 cut(s) 299
Cfr13I GGNCC 1 cut(s) 196
ClaI ATCGAT 1 cut(s) 134
CseI GACGC 1 cut(s) 98
CviAII CATG 2 cut(s) 248, 331
CviJI RGCY 3 cut(s) 197, 299, 319
CviKI_1 RGCY 3 cut(s) 197, 299, 319
DdeI CTNAG 1 cut(s) 155
DpnI GATC 5 cut(s) 78, 153, 167, 186, 246
DpnII GATC 5 cut(s) 76, 151, 165, 184, 244
Eam1104I CTCTTC 1 cut(s) 231
EarI CTCTTC 1 cut(s) 231
EcoO109I RGGNCCY 1 cut(s) 196
FaeI CATG 2 cut(s) 251, 334
FaiI YATR 5 cut(s) 11, 54, 122, 249, 332
FaqI GGGAC 2 cut(s) 116, 161
FatI CATG 2 cut(s) 247, 330
HaeIII GGCC 2 cut(s) 197, 299
HapII CCGG 1 cut(s) 300
HgaI GACGC 1 cut(s) 98
Hin1II CATG 2 cut(s) 251, 334
HincII GTYRAC 1 cut(s) 276
HindII GTYRAC 1 cut(s) 276
HinfI GANTC 1 cut(s) 277
HpaII CCGG 1 cut(s) 300
HphI GGTGA 1 cut(s) 86
Hpy166II GTNNAC 1 cut(s) 276
Hpy188I TCNGA 2 cut(s) 81, 189
Hpy188III TCNNGA 1 cut(s) 281
Hpy8I GTNNAC 1 cut(s) 276
Hpy99I CGWCG 1 cut(s) 92
HpyAV CCTTC 3 cut(s) 103, 108, 187
HpyCH4IV ACGT 1 cut(s) 174
HpyCH4V TGCA 2 cut(s) 13, 251
HpyF3I CTNAG 1 cut(s) 155
HpySE526I ACGT 1 cut(s) 174
Hsp92II CATG 2 cut(s) 251, 334
Kzo9I GATC 5 cut(s) 76, 151, 165, 184, 244
LmnI GCTCC 1 cut(s) 316
LpnPI CCDG 3 cut(s) 212, 299, 313
MaeII ACGT 1 cut(s) 174
MalI GATC 5 cut(s) 78, 153, 167, 186, 246
MboI GATC 5 cut(s) 76, 151, 165, 184, 244
MboII GAAGA 2 cut(s) 202, 248
MluCI AATT 4 cut(s) 24, 56, 218, 258
MlyI GAGTC 1 cut(s) 271
MmeI TCCRAC 1 cut(s) 222
MnlI CCTC 3 cut(s) 137, 238, 289
MseI TTAA 1 cut(s) 39
MspI CCGG 1 cut(s) 300
Mva1269I GAATGC 1 cut(s) 267
NdeII GATC 5 cut(s) 76, 151, 165, 184, 244
NlaIII CATG 2 cut(s) 251, 334
PctI GAATGC 1 cut(s) 267
PleI GAGTC 1 cut(s) 271
PpsI GAGTC 1 cut(s) 271
PspPI GGNCC 1 cut(s) 196
PstNI CAGNNNCTG 1 cut(s) 319
SaqAI TTAA 1 cut(s) 39
Sau3AI GATC 5 cut(s) 76, 151, 165, 184, 244
Sau96I GGNCC 1 cut(s) 196
SchI GAGTC 1 cut(s) 271
SetI ASST 2 cut(s) 177, 321
SfcI CTRYAG 1 cut(s) 311
SmlI CTYRAG 1 cut(s) 279
SmoI CTYRAG 1 cut(s) 279
Sse9I AATT 4 cut(s) 24, 56, 218, 258
TaiI ACGT 1 cut(s) 177
TaqI TCGA 3 cut(s) 65, 134, 234
TaqII GACCGA 1 cut(s) 300
TasI AATT 4 cut(s) 24, 56, 218, 258
Tru1I TTAA 1 cut(s) 39
Tru9I TTAA 1 cut(s) 39
TscAI CASTG 1 cut(s) 258
TspDTI ATGAA 1 cut(s) 69
TspGWI ACGGA 1 cut(s) 261
TspRI CASTG 1 cut(s) 258
XapI RAATTY 1 cut(s) 258
XcmI CCANNNNNNNNNTGG 1 cut(s) 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.