Rw4G036820

Oxygen evolving enhancer protein 3 (PsbQ)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
OG0009685
Physical Location & Seq
Reverse (-)
63633249 .. 63634796
1548 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G036820.1

Sequence Viewer

Length: 258 bp
ATGGACGACGCTTACTCGTGGGACTTGAAGGGAAGGGATATACGCCTCAAATCGATGTTCTTGTATTGTGATCTAAGTCAGTTGATCTCTAACGTCCCAAAGGATCAGAAGAATGCCCTGACAGAAGTTGGCAACAAATTGTTTTCCTCCATCGAAGAGTTGGATCATGCAGTGAAAATTCGTAGCATTCCGTTGACTCAAGACCGATACAACGAGGCCGGTGTCATTCTACAGGAGCTGATGGTTCTCATGCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00195 ko01100 map00195 map01100
Pfam Domains
Protein Families
PsbQ

Protein Analysis

85

Amino Acids

9.77

Weight (kDa)

4.96

Isoelectric Point (pI)

43.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PsbQ PF05757 7 - 85 5.9e-20 Oxygen evolving enhancer protein 3
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 111, 171
AcsI RAATTY 1 cut(s) 177
AgsI TTSAA 1 cut(s) 28
AluBI AGCT 1 cut(s) 238
AluI AGCT 1 cut(s) 238
AlwI GGATC 2 cut(s) 111, 171
AlwNI CAGNNNCTG 1 cut(s) 238
AoxI GGCC 1 cut(s) 216
ApoI RAATTY 1 cut(s) 177
BauI CACGAG 1 cut(s) 16
BccI CCATC 2 cut(s) 158, 235
BfmI CTRYAG 1 cut(s) 230
BpuEI CTTGAG 1 cut(s) 183
Bsa29I ATCGAT 1 cut(s) 53
Bse118I RCCGGY 1 cut(s) 218
BseCI ATCGAT 1 cut(s) 53
BshFI GGCC 1 cut(s) 218
BshVI ATCGAT 1 cut(s) 53
BsiSI CCGG 1 cut(s) 219
BslFI GGGAC 2 cut(s) 35, 80
BsmFI GGGAC 2 cut(s) 35, 80
BsmI GAATGC 2 cut(s) 118, 186
BsnI GGCC 1 cut(s) 218
Bsp143I GATC 4 cut(s) 70, 84, 103, 163
BspANI GGCC 1 cut(s) 218
BspDI ATCGAT 1 cut(s) 53
BspPI GGATC 2 cut(s) 111, 171
BsrFI RCCGGY 1 cut(s) 218
BssAI RCCGGY 1 cut(s) 218
BssMI GATC 4 cut(s) 70, 84, 103, 163
BssSI CACGAG 1 cut(s) 16
Bst2BI CACGAG 1 cut(s) 16
Bst6I CTCTTC 1 cut(s) 150
BstDEI CTNAG 1 cut(s) 74
BstKTI GATC 4 cut(s) 73, 87, 106, 166
BstMBI GATC 4 cut(s) 70, 84, 103, 163
BstSFI CTRYAG 1 cut(s) 230
Bsu15I ATCGAT 1 cut(s) 53
BsuRI GGCC 1 cut(s) 218
BsuTUI ATCGAT 1 cut(s) 53
BtsI GCAGTG 1 cut(s) 177
BtsIMutI CAGTG 1 cut(s) 177
CaiI CAGNNNCTG 1 cut(s) 238
Cfr10I RCCGGY 1 cut(s) 218
ClaI ATCGAT 1 cut(s) 53
CseI GACGC 1 cut(s) 17
CviAII CATG 2 cut(s) 167, 250
CviJI RGCY 2 cut(s) 218, 238
CviKI_1 RGCY 2 cut(s) 218, 238
DdeI CTNAG 1 cut(s) 74
DpnI GATC 4 cut(s) 72, 86, 105, 165
DpnII GATC 4 cut(s) 70, 84, 103, 163
Eam1104I CTCTTC 1 cut(s) 150
EarI CTCTTC 1 cut(s) 150
FaeI CATG 2 cut(s) 170, 253
FaiI YATR 3 cut(s) 41, 168, 251
FaqI GGGAC 2 cut(s) 35, 80
FatI CATG 2 cut(s) 166, 249
HaeIII GGCC 1 cut(s) 218
HapII CCGG 1 cut(s) 219
HgaI GACGC 1 cut(s) 17
Hin1II CATG 2 cut(s) 170, 253
HincII GTYRAC 1 cut(s) 195
HindII GTYRAC 1 cut(s) 195
HinfI GANTC 1 cut(s) 196
HpaII CCGG 1 cut(s) 219
Hpy166II GTNNAC 1 cut(s) 195
Hpy188I TCNGA 1 cut(s) 108
Hpy188III TCNNGA 1 cut(s) 200
Hpy8I GTNNAC 1 cut(s) 195
Hpy99I CGWCG 1 cut(s) 11
HpyAV CCTTC 2 cut(s) 22, 27
HpyCH4IV ACGT 1 cut(s) 93
HpyCH4V TGCA 1 cut(s) 170
HpyF3I CTNAG 1 cut(s) 74
HpySE526I ACGT 1 cut(s) 93
Hsp92II CATG 2 cut(s) 170, 253
Kzo9I GATC 4 cut(s) 70, 84, 103, 163
LmnI GCTCC 1 cut(s) 235
LpnPI CCDG 3 cut(s) 131, 218, 232
MaeII ACGT 1 cut(s) 93
MalI GATC 4 cut(s) 72, 86, 105, 165
MboI GATC 4 cut(s) 70, 84, 103, 163
MboII GAAGA 2 cut(s) 121, 167
MluCI AATT 2 cut(s) 137, 177
MlyI GAGTC 1 cut(s) 190
MmeI TCCRAC 1 cut(s) 141
MnlI CCTC 3 cut(s) 56, 157, 208
MspI CCGG 1 cut(s) 219
Mva1269I GAATGC 2 cut(s) 118, 186
NdeII GATC 4 cut(s) 70, 84, 103, 163
NlaIII CATG 2 cut(s) 170, 253
PctI GAATGC 2 cut(s) 118, 186
PleI GAGTC 1 cut(s) 190
PpsI GAGTC 1 cut(s) 190
PstNI CAGNNNCTG 1 cut(s) 238
Sau3AI GATC 4 cut(s) 70, 84, 103, 163
SchI GAGTC 1 cut(s) 190
SetI ASST 2 cut(s) 96, 240
SfcI CTRYAG 1 cut(s) 230
SmlI CTYRAG 1 cut(s) 198
SmoI CTYRAG 1 cut(s) 198
Sse9I AATT 2 cut(s) 137, 177
TaiI ACGT 1 cut(s) 96
TaqI TCGA 2 cut(s) 53, 153
TaqII GACCGA 1 cut(s) 219
TasI AATT 2 cut(s) 137, 177
TscAI CASTG 1 cut(s) 177
TspGWI ACGGA 1 cut(s) 180
TspRI CASTG 1 cut(s) 177
XapI RAATTY 1 cut(s) 177
XcmI CCANNNNNNNNNTGG 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.